ID: 1058544911

View in Genome Browser
Species Human (GRCh38)
Location 9:106050943-106050965
Sequence GGAATGTAAGTAGTTTATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058544911_1058544918 6 Left 1058544911 9:106050943-106050965 CCTACATAAACTACTTACATTCC No data
Right 1058544918 9:106050972-106050994 TGTCTTCGGGTCTGCTTCTGGGG No data
1058544911_1058544913 -7 Left 1058544911 9:106050943-106050965 CCTACATAAACTACTTACATTCC No data
Right 1058544913 9:106050959-106050981 ACATTCCCATCTTTGTCTTCGGG No data
1058544911_1058544916 4 Left 1058544911 9:106050943-106050965 CCTACATAAACTACTTACATTCC No data
Right 1058544916 9:106050970-106050992 TTTGTCTTCGGGTCTGCTTCTGG No data
1058544911_1058544912 -8 Left 1058544911 9:106050943-106050965 CCTACATAAACTACTTACATTCC No data
Right 1058544912 9:106050958-106050980 TACATTCCCATCTTTGTCTTCGG No data
1058544911_1058544917 5 Left 1058544911 9:106050943-106050965 CCTACATAAACTACTTACATTCC No data
Right 1058544917 9:106050971-106050993 TTGTCTTCGGGTCTGCTTCTGGG No data
1058544911_1058544919 7 Left 1058544911 9:106050943-106050965 CCTACATAAACTACTTACATTCC No data
Right 1058544919 9:106050973-106050995 GTCTTCGGGTCTGCTTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058544911 Original CRISPR GGAATGTAAGTAGTTTATGT AGG (reversed) Intergenic
No off target data available for this crispr