ID: 1058544912

View in Genome Browser
Species Human (GRCh38)
Location 9:106050958-106050980
Sequence TACATTCCCATCTTTGTCTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058544908_1058544912 18 Left 1058544908 9:106050917-106050939 CCCTATTGGAATTTCCTGGGATT No data
Right 1058544912 9:106050958-106050980 TACATTCCCATCTTTGTCTTCGG No data
1058544909_1058544912 17 Left 1058544909 9:106050918-106050940 CCTATTGGAATTTCCTGGGATTG No data
Right 1058544912 9:106050958-106050980 TACATTCCCATCTTTGTCTTCGG No data
1058544911_1058544912 -8 Left 1058544911 9:106050943-106050965 CCTACATAAACTACTTACATTCC No data
Right 1058544912 9:106050958-106050980 TACATTCCCATCTTTGTCTTCGG No data
1058544907_1058544912 19 Left 1058544907 9:106050916-106050938 CCCCTATTGGAATTTCCTGGGAT No data
Right 1058544912 9:106050958-106050980 TACATTCCCATCTTTGTCTTCGG No data
1058544910_1058544912 4 Left 1058544910 9:106050931-106050953 CCTGGGATTGCTCCTACATAAAC No data
Right 1058544912 9:106050958-106050980 TACATTCCCATCTTTGTCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058544912 Original CRISPR TACATTCCCATCTTTGTCTT CGG Intergenic
No off target data available for this crispr