ID: 1058545314

View in Genome Browser
Species Human (GRCh38)
Location 9:106054876-106054898
Sequence CCTGTGCACCAGTCAGTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058545311_1058545314 -8 Left 1058545311 9:106054861-106054883 CCATATCCAGTGGCTCCTGTGCA No data
Right 1058545314 9:106054876-106054898 CCTGTGCACCAGTCAGTTTTTGG No data
1058545307_1058545314 28 Left 1058545307 9:106054825-106054847 CCATTTGTGATCTTATTACACAA No data
Right 1058545314 9:106054876-106054898 CCTGTGCACCAGTCAGTTTTTGG No data
1058545310_1058545314 -2 Left 1058545310 9:106054855-106054877 CCTCTACCATATCCAGTGGCTCC No data
Right 1058545314 9:106054876-106054898 CCTGTGCACCAGTCAGTTTTTGG No data
1058545309_1058545314 -1 Left 1058545309 9:106054854-106054876 CCCTCTACCATATCCAGTGGCTC No data
Right 1058545314 9:106054876-106054898 CCTGTGCACCAGTCAGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058545314 Original CRISPR CCTGTGCACCAGTCAGTTTT TGG Intergenic
No off target data available for this crispr