ID: 1058551190

View in Genome Browser
Species Human (GRCh38)
Location 9:106116662-106116684
Sequence CCCATTGCACAGATGAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058551187_1058551190 0 Left 1058551187 9:106116639-106116661 CCAAATAACTTTGGTATTATTAT No data
Right 1058551190 9:106116662-106116684 CCCATTGCACAGATGAAGGATGG No data
1058551186_1058551190 1 Left 1058551186 9:106116638-106116660 CCCAAATAACTTTGGTATTATTA No data
Right 1058551190 9:106116662-106116684 CCCATTGCACAGATGAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058551190 Original CRISPR CCCATTGCACAGATGAAGGA TGG Intergenic
No off target data available for this crispr