ID: 1058565396

View in Genome Browser
Species Human (GRCh38)
Location 9:106279007-106279029
Sequence ACATTTAGCTGTGAGCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058565396_1058565398 12 Left 1058565396 9:106279007-106279029 CCAGGAAGCTCACAGCTAAATGT No data
Right 1058565398 9:106279042-106279064 CTTTCCTAACAGTTGGTGTCAGG No data
1058565396_1058565397 5 Left 1058565396 9:106279007-106279029 CCAGGAAGCTCACAGCTAAATGT No data
Right 1058565397 9:106279035-106279057 TTAGATACTTTCCTAACAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058565396 Original CRISPR ACATTTAGCTGTGAGCTTCC TGG (reversed) Intergenic
No off target data available for this crispr