ID: 1058565398

View in Genome Browser
Species Human (GRCh38)
Location 9:106279042-106279064
Sequence CTTTCCTAACAGTTGGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058565396_1058565398 12 Left 1058565396 9:106279007-106279029 CCAGGAAGCTCACAGCTAAATGT No data
Right 1058565398 9:106279042-106279064 CTTTCCTAACAGTTGGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058565398 Original CRISPR CTTTCCTAACAGTTGGTGTC AGG Intergenic
No off target data available for this crispr