ID: 1058565425

View in Genome Browser
Species Human (GRCh38)
Location 9:106279291-106279313
Sequence CCCCCTTTAAAATTTTTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058565425_1058565428 9 Left 1058565425 9:106279291-106279313 CCCTTAAAAAATTTTAAAGGGGG No data
Right 1058565428 9:106279323-106279345 ATCTGTAAATAAATATTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058565425 Original CRISPR CCCCCTTTAAAATTTTTTAA GGG (reversed) Intergenic
No off target data available for this crispr