ID: 1058567137

View in Genome Browser
Species Human (GRCh38)
Location 9:106298054-106298076
Sequence CAGTGTAGTCAGAGAAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058567131_1058567137 13 Left 1058567131 9:106298018-106298040 CCTAAAAGGGTTTCCAAGGAAGG No data
Right 1058567137 9:106298054-106298076 CAGTGTAGTCAGAGAAAAGAGGG No data
1058567134_1058567137 0 Left 1058567134 9:106298031-106298053 CCAAGGAAGGAAATGGCAACCAG No data
Right 1058567137 9:106298054-106298076 CAGTGTAGTCAGAGAAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058567137 Original CRISPR CAGTGTAGTCAGAGAAAAGA GGG Intergenic
No off target data available for this crispr