ID: 1058567546

View in Genome Browser
Species Human (GRCh38)
Location 9:106302661-106302683
Sequence GCCCATGCCATGAAAATAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058567543_1058567546 28 Left 1058567543 9:106302610-106302632 CCACACGTTGTTTGCTAATACAC No data
Right 1058567546 9:106302661-106302683 GCCCATGCCATGAAAATAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058567546 Original CRISPR GCCCATGCCATGAAAATAGG AGG Intergenic
No off target data available for this crispr