ID: 1058572603

View in Genome Browser
Species Human (GRCh38)
Location 9:106363788-106363810
Sequence CTGTGTTCTCACATGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058572601_1058572603 -4 Left 1058572601 9:106363769-106363791 CCTTCATAGAGGAGAAATGCTGT No data
Right 1058572603 9:106363788-106363810 CTGTGTTCTCACATGGAACAAGG No data
1058572598_1058572603 21 Left 1058572598 9:106363744-106363766 CCAAGATGGTGACTTGTTGCTGC 0: 4
1: 38
2: 135
3: 283
4: 459
Right 1058572603 9:106363788-106363810 CTGTGTTCTCACATGGAACAAGG No data
1058572600_1058572603 -3 Left 1058572600 9:106363768-106363790 CCCTTCATAGAGGAGAAATGCTG No data
Right 1058572603 9:106363788-106363810 CTGTGTTCTCACATGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058572603 Original CRISPR CTGTGTTCTCACATGGAACA AGG Intergenic
No off target data available for this crispr