ID: 1058575080

View in Genome Browser
Species Human (GRCh38)
Location 9:106392391-106392413
Sequence GTCACAGCTCAGAGAGGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058575080_1058575082 -5 Left 1058575080 9:106392391-106392413 CCTTAACCTCTCTGAGCTGTGAC No data
Right 1058575082 9:106392409-106392431 GTGACACACCCAAATGTGAGAGG No data
1058575080_1058575086 21 Left 1058575080 9:106392391-106392413 CCTTAACCTCTCTGAGCTGTGAC No data
Right 1058575086 9:106392435-106392457 TGAATCAGAGCTGCCTCGAATGG No data
1058575080_1058575083 -2 Left 1058575080 9:106392391-106392413 CCTTAACCTCTCTGAGCTGTGAC No data
Right 1058575083 9:106392412-106392434 ACACACCCAAATGTGAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058575080 Original CRISPR GTCACAGCTCAGAGAGGTTA AGG (reversed) Intergenic
No off target data available for this crispr