ID: 1058580757

View in Genome Browser
Species Human (GRCh38)
Location 9:106454009-106454031
Sequence TTGGACACACAGAACACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058580757_1058580760 -3 Left 1058580757 9:106454009-106454031 CCCTGTGTGTTCTGTGTGTCCAA No data
Right 1058580760 9:106454029-106454051 CAATTTTCCCTTTTCTCATAAGG No data
1058580757_1058580763 11 Left 1058580757 9:106454009-106454031 CCCTGTGTGTTCTGTGTGTCCAA No data
Right 1058580763 9:106454043-106454065 CTCATAAGGATACAAATCACTGG No data
1058580757_1058580765 18 Left 1058580757 9:106454009-106454031 CCCTGTGTGTTCTGTGTGTCCAA No data
Right 1058580765 9:106454050-106454072 GGATACAAATCACTGGTTTAGGG No data
1058580757_1058580764 17 Left 1058580757 9:106454009-106454031 CCCTGTGTGTTCTGTGTGTCCAA No data
Right 1058580764 9:106454049-106454071 AGGATACAAATCACTGGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058580757 Original CRISPR TTGGACACACAGAACACACA GGG (reversed) Intergenic
No off target data available for this crispr