ID: 1058585043

View in Genome Browser
Species Human (GRCh38)
Location 9:106498701-106498723
Sequence CATTCCAACTGTACTCCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058585042_1058585043 10 Left 1058585042 9:106498668-106498690 CCTCAAGCATTCATTACGTCTTT No data
Right 1058585043 9:106498701-106498723 CATTCCAACTGTACTCCTTTTGG No data
1058585041_1058585043 17 Left 1058585041 9:106498661-106498683 CCTATTACCTCAAGCATTCATTA No data
Right 1058585043 9:106498701-106498723 CATTCCAACTGTACTCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058585043 Original CRISPR CATTCCAACTGTACTCCTTT TGG Intergenic
No off target data available for this crispr