ID: 1058585897

View in Genome Browser
Species Human (GRCh38)
Location 9:106505805-106505827
Sequence CTGGCTTTGCAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058585897_1058585901 -4 Left 1058585897 9:106505805-106505827 CCTTCCTCCTTCTGCAAAGCCAG No data
Right 1058585901 9:106505824-106505846 CCAGCAACATTCCATCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058585897 Original CRISPR CTGGCTTTGCAGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr