ID: 1058585901

View in Genome Browser
Species Human (GRCh38)
Location 9:106505824-106505846
Sequence CCAGCAACATTCCATCTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058585895_1058585901 11 Left 1058585895 9:106505790-106505812 CCTTGGCCTGTGGCTCCTTCCTC No data
Right 1058585901 9:106505824-106505846 CCAGCAACATTCCATCTCTCTGG No data
1058585897_1058585901 -4 Left 1058585897 9:106505805-106505827 CCTTCCTCCTTCTGCAAAGCCAG No data
Right 1058585901 9:106505824-106505846 CCAGCAACATTCCATCTCTCTGG No data
1058585896_1058585901 5 Left 1058585896 9:106505796-106505818 CCTGTGGCTCCTTCCTCCTTCTG No data
Right 1058585901 9:106505824-106505846 CCAGCAACATTCCATCTCTCTGG No data
1058585894_1058585901 16 Left 1058585894 9:106505785-106505807 CCATTCCTTGGCCTGTGGCTCCT No data
Right 1058585901 9:106505824-106505846 CCAGCAACATTCCATCTCTCTGG No data
1058585893_1058585901 17 Left 1058585893 9:106505784-106505806 CCCATTCCTTGGCCTGTGGCTCC No data
Right 1058585901 9:106505824-106505846 CCAGCAACATTCCATCTCTCTGG No data
1058585892_1058585901 18 Left 1058585892 9:106505783-106505805 CCCCATTCCTTGGCCTGTGGCTC No data
Right 1058585901 9:106505824-106505846 CCAGCAACATTCCATCTCTCTGG No data
1058585890_1058585901 22 Left 1058585890 9:106505779-106505801 CCAGCCCCATTCCTTGGCCTGTG No data
Right 1058585901 9:106505824-106505846 CCAGCAACATTCCATCTCTCTGG No data
1058585898_1058585901 -8 Left 1058585898 9:106505809-106505831 CCTCCTTCTGCAAAGCCAGCAAC No data
Right 1058585901 9:106505824-106505846 CCAGCAACATTCCATCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058585901 Original CRISPR CCAGCAACATTCCATCTCTC TGG Intergenic
No off target data available for this crispr