ID: 1058587462

View in Genome Browser
Species Human (GRCh38)
Location 9:106525602-106525624
Sequence CTGGAGACTCAGAAGGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1014
Summary {0: 2, 1: 10, 2: 85, 3: 237, 4: 680}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058587462 Original CRISPR CTGGAGACTCAGAAGGGGGT GGG Intergenic
900172147 1:1274246-1274268 CTGGAGGCTCAGTGGAGGGTTGG + Intergenic
900987009 1:6078962-6078984 CTGGAGGCTCAGAGCAGGGTGGG + Intronic
900998221 1:6134260-6134282 CTGCAGACACAGCAGGAGGTGGG + Intronic
901198001 1:7451086-7451108 CTGGAGCCTCAGCAGGGTCTGGG - Intronic
901748283 1:11389129-11389151 CTGCAGACTCAGAGGGGGGAAGG - Intergenic
901781372 1:11596934-11596956 CTTGGGACTCAGGAGGGTGTTGG + Intergenic
902256671 1:15193516-15193538 CTGGACTCTCAGAAGTGGCTGGG + Intronic
902269138 1:15290437-15290459 CTGGGGACTCCGAAGGGCCTGGG - Intronic
902381664 1:16055664-16055686 CTGGAGACACTGCTGGGGGTGGG - Exonic
903281109 1:22250485-22250507 CTGGTGACTCAGATGGGGAGGGG + Intergenic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
904756362 1:32770795-32770817 CTGGTGGCTCAGAAGGGGCGGGG + Exonic
904803382 1:33113445-33113467 CTGGAAAATCTTAAGGGGGTGGG - Intronic
904889665 1:33770439-33770461 CTGGGTACTCAGTAGGGAGTGGG + Intronic
905293101 1:36936585-36936607 CTGGAGAATGGGAATGGGGTGGG - Intronic
905794355 1:40807274-40807296 CTGGAGAGTCACAAGGCGGAAGG + Intronic
906080689 1:43086410-43086432 GTAGAGACACAGAAGGGGTTGGG - Intergenic
906520853 1:46466247-46466269 CTGGACACACAGAAGGCGCTGGG + Intergenic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
906953205 1:50350783-50350805 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
906994254 1:50773315-50773337 CTGCAGACTCAGAAGTGGGATGG - Intronic
907375430 1:54034236-54034258 CTGGAGGGTGAGATGGGGGTAGG + Intronic
907430226 1:54406924-54406946 CTGGAGTCTGGGGAGGGGGTCGG - Intronic
907582569 1:55585096-55585118 CTGGAAACAAAGAATGGGGTGGG - Intergenic
907944922 1:59127115-59127137 CTGAAGACACAGAAAGGTGTGGG + Intergenic
908253878 1:62286752-62286774 CTGGGGCCCCAGGAGGGGGTAGG - Intronic
908771778 1:67603921-67603943 TTGGAGACTCAGAAATGGGGAGG + Intergenic
908959377 1:69676936-69676958 CTGGAGACTCAGAAGGGAAAGGG - Intronic
909540491 1:76786270-76786292 CTGGAAACTCTTAAGGGGATGGG - Intergenic
910086935 1:83414212-83414234 TTAAAGACTCAGAAAGGGGTGGG + Intergenic
910101648 1:83583718-83583740 CTGCCAACTCAGAAGCGGGTGGG + Intergenic
911182727 1:94875502-94875524 CAGGAGGCTCAGAAGGGGCAAGG - Intronic
911288805 1:96029328-96029350 CTGCCAACTCAGAAGGGGGCAGG + Intergenic
911457797 1:98148905-98148927 TTAGAGACTCAGAAGGGGAAAGG + Intergenic
911795329 1:102068738-102068760 TTAGAGATTCAGAAGGGGGAGGG + Intergenic
911946207 1:104112760-104112782 TTGGAGACTCAAAAGGGGGAAGG - Intergenic
912003539 1:104864322-104864344 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
912708231 1:111930607-111930629 ATGGTTACTGAGAAGGGGGTTGG - Intronic
913241290 1:116832175-116832197 GAGGAGACTCAGAAGATGGTGGG - Intergenic
915058306 1:153157907-153157929 CAGGAGACAGAGAGGGGGGTGGG + Intergenic
915118691 1:153615533-153615555 CTGGAGGCCGAGCAGGGGGTGGG - Intronic
915565123 1:156708661-156708683 CTGGAGACTCAGTGAGGGGAGGG + Intergenic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916453244 1:164941860-164941882 TTGGAGACTCTGAAGGGAGGAGG - Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916902779 1:169247640-169247662 TTGGCGACTCAGAAGAGGGAGGG - Intronic
917410822 1:174758452-174758474 TTGGAGACTCAGAAGGGGAAAGG - Intronic
917422897 1:174883408-174883430 CTGGAGACGCAGGAGGAGTTGGG + Intronic
917478318 1:175387750-175387772 CTGGAGACAGAGTAGGAGGTGGG - Intronic
917917569 1:179718878-179718900 CTGGAGACTCCAAAAGGGGAGGG - Intergenic
918002435 1:180510087-180510109 TTAGAGACTCAGCAGGGGGAGGG - Intergenic
918566880 1:185944302-185944324 TTGAAGACTCAGAAGGGAGAGGG + Intronic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
918928876 1:190826700-190826722 ATGGAGATTCAGAAGGGTGAGGG + Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919613993 1:199782164-199782186 TTGGAGACTGAGAAGAGGGGGGG + Intergenic
919920056 1:202162133-202162155 CTGGGGACACAGGAGGGGGCAGG + Intergenic
920019675 1:202945849-202945871 ATGGAGACTTAGAAGCGGGAGGG + Intronic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
920990599 1:210935353-210935375 CTAGAGACTGAGAAGGGGAGAGG + Intronic
922237652 1:223734004-223734026 CTGCAGACTCAGGAGGAGGGAGG + Intronic
922279001 1:224104828-224104850 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
922860832 1:228814946-228814968 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
922979797 1:229816135-229816157 TTTGAGAATCACAAGGGGGTGGG - Intergenic
922995053 1:229950307-229950329 GTAGAGACTCAGAAGCGGGAGGG - Intergenic
923060644 1:230469827-230469849 GTAGAGACTCAGAAGGGGCGGGG - Intergenic
923249345 1:232165764-232165786 TTGGAGACTCAGAGTGGGGAGGG + Intergenic
923751194 1:236747496-236747518 GTGGAGGCTCAGAAGGGTGAGGG - Intronic
923880903 1:238103176-238103198 TTAGAGACTCAGCAGGGGGAAGG - Intergenic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
924621992 1:245669971-245669993 TTGGAGACTCCGAAGGGGAAAGG + Intronic
1063281520 10:4634289-4634311 TTGGAGACTGAGAAGGAGGGAGG + Intergenic
1063837331 10:10030578-10030600 CTGAAGACTCAGAAGCAGGGAGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064594216 10:16926984-16927006 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1064662825 10:17623423-17623445 GTGGAGACTCAGAAGCAGGGAGG - Intergenic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065127127 10:22584481-22584503 CTGGAGAAACAGAAGGGGAGAGG + Intronic
1065187739 10:23185411-23185433 TTGCAGACTCAGAAGTGGGGTGG + Intergenic
1065319690 10:24497813-24497835 TTGGAGACTCAGAAGTGGGCAGG + Intronic
1065423677 10:25576202-25576224 CTGGAGACTCAGAAGGGGTTAGG - Intronic
1066173198 10:32874439-32874461 CTGGAGGCTCAGAAGGGGAGAGG - Intronic
1066597788 10:37071062-37071084 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1066750180 10:38647090-38647112 TTGGGTTCTCAGAAGGGGGTTGG + Intergenic
1066994790 10:42553583-42553605 TTAGAGACTCAGAAGGGGGCTGG + Intergenic
1067182079 10:43995867-43995889 CCGGAGACTCACAAGTGGGGAGG + Intergenic
1067784394 10:49233229-49233251 TGGGAGACTCAGAATGGGGGAGG + Intergenic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1068117055 10:52747039-52747061 CAGCAGACTCAGAATGGAGTGGG - Intergenic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1068553280 10:58429594-58429616 ATGGAGACTCAGAAGAGTGAAGG - Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1068833615 10:61526666-61526688 CTGGAGACTCAGGAGGGTGCAGG + Intergenic
1068981744 10:63070012-63070034 CTGTAGACTCAGAAAATGGTTGG + Intergenic
1069238184 10:66104601-66104623 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1069486596 10:68827678-68827700 CTGGAGGCGCAGAAGGCGGCGGG + Exonic
1069486683 10:68828014-68828036 CTGGAGGCGCAGAAGGCGGCGGG + Intronic
1070103495 10:73411284-73411306 TTAGAGACTCAGAAAGGGGAGGG + Intronic
1071148294 10:82600948-82600970 CTGGAGACTCCAAAAGGGGTGGG - Intronic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1072184011 10:93017249-93017271 CCAGAGACTCAAAAGGGGGAGGG + Intronic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072872907 10:99139271-99139293 CTGGAGACTCAGAAGCAGAAGGG + Intronic
1073047015 10:100645460-100645482 CAGGAGACTCGGCAGGGGCTGGG - Intergenic
1073790465 10:106934899-106934921 CTGGAAACTCAGAAAAGGGAGGG + Intronic
1074210448 10:111328269-111328291 CTGGAGACTCCGAAGGGAGTGGG + Intergenic
1074734847 10:116419596-116419618 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
1075093709 10:119457608-119457630 CTGGGGACTCAGTAGGGAGAAGG - Intronic
1075222890 10:120600267-120600289 CTGGAAAGTCACAAGGGGGATGG + Intergenic
1075615131 10:123885201-123885223 CTGGGGACTCAGGGTGGGGTTGG + Intronic
1075643608 10:124083289-124083311 CTGCTGACTCAAAAGGGGGCAGG + Intronic
1075987653 10:126801404-126801426 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1076290773 10:129343710-129343732 CTGGAGAGTCAAAAAGGGCTTGG + Intergenic
1076347583 10:129790391-129790413 TTAGAGACTCAGAAGCGGGAGGG + Intergenic
1077076282 11:703629-703651 CTGGAGACGCAGGATGGGGTAGG + Intronic
1077439828 11:2562624-2562646 CTGGAGACTCTGAAGAGGGGTGG - Intronic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1079252897 11:18800409-18800431 CTGGAGACTTGGAAGGGTGAAGG + Intergenic
1079812812 11:25016308-25016330 TTACAGACTCAGAAGGGGGAAGG - Intronic
1079879842 11:25913012-25913034 CTGGAGACTCAAAAGTGGGAAGG + Intergenic
1080333805 11:31174013-31174035 CTGAAAACTCAGAAGGGTGTAGG - Intronic
1080510706 11:32967310-32967332 TTGGAGACTCAGAAGGGGAGAGG + Intronic
1080609292 11:33890128-33890150 CTGGAGACTCAGAAGGGTGGGGG + Intronic
1080675792 11:34425551-34425573 TTTGAGACTCAGAAGGGGGAGGG + Intergenic
1080795840 11:35562431-35562453 ATGGAGACTGAGTAGGGGCTGGG + Intergenic
1081026129 11:38017428-38017450 CTGTAGACTCAGGAGTAGGTGGG - Intergenic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1081405808 11:42696267-42696289 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
1081412032 11:42771038-42771060 CTGGGGACTGAAGAGGGGGTTGG - Intergenic
1082119269 11:48360618-48360640 TTGGAGACTCAGAAGCGGGAAGG + Intergenic
1082202983 11:49396303-49396325 TTTGAGACTCAGAAGGTGGGAGG - Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083831423 11:65236316-65236338 GTGGAGCCTCAGGAGGGGATAGG - Intergenic
1084096586 11:66915443-66915465 CTGGAGACACAGCAGGGAGAAGG - Intronic
1084710800 11:70842748-70842770 CTGGAGGCTCCCAGGGGGGTGGG + Intronic
1084721357 11:70907459-70907481 CAGGAGCCTGAGAAGGGGGGAGG - Intronic
1084740527 11:71136475-71136497 CAGGAGACTCAGAAGGGTGGTGG + Intronic
1084941073 11:72613652-72613674 CTGGAGACACAGGAGTAGGTGGG - Intronic
1085717591 11:78886688-78886710 CTGGAGAGTCAGCAAGGTGTTGG - Intronic
1085886334 11:80526724-80526746 CTGGAGACCCAGAAGAGGGGAGG + Intergenic
1086049252 11:82569328-82569350 ATGGAAGCTCAGAAGGGGGATGG - Intergenic
1088554126 11:111044332-111044354 AAGGAGACTCAGAAGGGTGGGGG - Intergenic
1089549099 11:119256722-119256744 TTAGAGACTCAGAAGCGGGGAGG - Intronic
1089573281 11:119423601-119423623 CTGGAGGCTCCGGAGGAGGTGGG - Exonic
1089813606 11:121152564-121152586 CTGGAGATTCAGATGGGCGGTGG + Intronic
1090063600 11:123484856-123484878 CTGGAGACTCTTAACTGGGTAGG - Intergenic
1090667759 11:128926111-128926133 CTTGGGACACAGAAGGGGCTTGG - Intergenic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091747032 12:2999235-2999257 CTGGGGGCTCAGAATGGGGCTGG - Intronic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092330090 12:7578764-7578786 TTGGAGACACAGAACAGGGTAGG - Intergenic
1092549104 12:9478384-9478406 CTGGAGACTTGGGAAGGGGTGGG + Intergenic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1094166887 12:27452350-27452372 ATGGAGACTCAGGAGGGTGAAGG - Intergenic
1094415903 12:30214547-30214569 TTGGAAACTCAGAAGGGTGGTGG - Intergenic
1094503891 12:31044083-31044105 CTGGAGACTTGGGAAGGGGTGGG - Intergenic
1094619895 12:32069979-32070001 ATGGGGACTCAGAAGGGTGGCGG - Intergenic
1094816512 12:34191756-34191778 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1095184613 12:39187047-39187069 CTGGGGACCCAGAAGGGAGATGG - Intergenic
1095557914 12:43529640-43529662 TTGGAGACTCAGAAGCGGGAGGG + Intronic
1096262282 12:50100321-50100343 CAGGAGCCTGAGGAGGGGGTGGG - Exonic
1096773122 12:53949188-53949210 CTGGAGACTAAGATGTGGGTGGG - Intergenic
1097053824 12:56238648-56238670 CTGGAGCTGGAGAAGGGGGTAGG + Exonic
1097226490 12:57479443-57479465 CTGGAGACCCAGAAGGGAATAGG + Intronic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097477657 12:60078625-60078647 TTGGAGACTCAGAAGGGGATAGG - Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1098003538 12:65970771-65970793 CTGAAGACTGAGGAGGAGGTTGG - Intergenic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098480314 12:70950286-70950308 TTGGAGACTCAGAAGGGATGAGG - Intergenic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099164156 12:79281519-79281541 CTGGAGACTCAAAAGTGGGAAGG + Intronic
1099355119 12:81624812-81624834 TCAGAGACTCAGAAGGGGGAGGG + Intronic
1099938035 12:89151387-89151409 ATGAAGACTCAGAATGGGGAGGG + Intergenic
1100292076 12:93225309-93225331 TTGGAGACTAAGAAGAGGGAAGG - Intergenic
1100322188 12:93506221-93506243 TTGAAGACTCAGAAGAGGCTGGG - Exonic
1100762555 12:97825327-97825349 TTGGAGAATCAGAAGGGAGTGGG - Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101411494 12:104472564-104472586 ATGGAGACTCAGAAGGATTTAGG + Intronic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101520439 12:105477550-105477572 TTAGAGACTCAGAAAGGGGAAGG - Intergenic
1101946738 12:109143129-109143151 TTGGAGACTCAGAGAGGGGAAGG - Intronic
1102453140 12:113056192-113056214 CAGGAGATTCAGATCGGGGTTGG + Intergenic
1102897308 12:116608953-116608975 CTGGAGACTCAGAAGCGGGGCGG + Intergenic
1102946370 12:116992557-116992579 CTAGAGACTCAGAAGGGTACTGG - Intronic
1103105680 12:118222761-118222783 TTGGAGACTCAGAAGAGGAAGGG + Intronic
1103277746 12:119727437-119727459 CTGTGGATTCAGAAGGGGGAAGG + Intronic
1104394549 12:128421154-128421176 CTAGAGACTCGGAAGGGGAGAGG - Intronic
1104483460 12:129128755-129128777 CTGGAGACTCCCAAGGGTGGGGG - Intronic
1104536616 12:129623432-129623454 TTAGAGACTCAGAAGAGGGGAGG - Intronic
1104809045 12:131609505-131609527 CTAGAGGCTCAGAAGGAGGAGGG - Intergenic
1105592263 13:21803604-21803626 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1106070523 13:26406963-26406985 CTGGACAGCCAGAAGGGGGGAGG - Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108096691 13:46909118-46909140 CTGGAGACTCAGAAGTGAGGAGG - Intergenic
1108456815 13:50624054-50624076 CTGGAAACTCAGAAAGGAGAGGG - Intronic
1108493230 13:51001375-51001397 CTGGAGCCTGAGAAGCAGGTTGG + Intergenic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1108822425 13:54369604-54369626 TTGGAGGCTCAGAAGGGAGAGGG - Intergenic
1108875948 13:55051301-55051323 CTGGAGATTCAGAAGAGAGAAGG + Intergenic
1108976642 13:56452319-56452341 TTGGAGACTCAGAATAGGGGAGG - Intergenic
1109396657 13:61766905-61766927 CTGCCAACTCAGAAGGGGCTCGG + Intergenic
1109483629 13:62990278-62990300 TTGGAAACTCAGAAGGGAGAGGG - Intergenic
1109940797 13:69361373-69361395 TTGAAGACTCAGAAGGGGGAAGG + Intergenic
1110094257 13:71496547-71496569 ATTGAGACTCAGAAGGGTGTGGG + Intronic
1110845098 13:80184448-80184470 GTAGAGACACAGAAGGGGTTGGG - Intergenic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1111394831 13:87651779-87651801 CTGGGGACTCCAAAGGGGGGAGG - Intergenic
1112137371 13:96596101-96596123 CTGGAGATTCACAAGGGGAGAGG - Intronic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113050290 13:106203835-106203857 TTGGAGACTCAGAGGGGGAAGGG - Intergenic
1114010926 14:18367635-18367657 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1114489672 14:23091480-23091502 CTGGCTACTCAGGAGGTGGTGGG + Intronic
1114648809 14:24270325-24270347 CTGGAGACTCAGAAGTGCGTAGG - Exonic
1114661987 14:24352609-24352631 TTGGAGACTCAGATGTGGGAAGG + Intergenic
1114952514 14:27773645-27773667 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1115467193 14:33728423-33728445 CTGAAGACTCACAACTGGGTAGG + Intronic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116401254 14:44510389-44510411 ATGGAGACTCAGAAGTGTGTGGG - Intergenic
1116422464 14:44748793-44748815 CTAGAGACTAAGAAGGGTGGGGG + Intergenic
1116693851 14:48147220-48147242 CTGGAGACTCAGAAGGGCAGAGG + Intergenic
1116754774 14:48933362-48933384 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1116762786 14:49035343-49035365 CTGGAGATTCAGAAGGGTGGGGG + Intergenic
1116993654 14:51301232-51301254 CCGGAGACACAGAAAAGGGTGGG - Intergenic
1117207162 14:53455300-53455322 CTGGAGACTCAGAAAGAGTGAGG + Intergenic
1117517965 14:56521377-56521399 TTGGAGAGTTAGAAGGGGGAGGG - Intronic
1117740135 14:58809526-58809548 ATGGAGTCTCAGAAGGGTGAGGG - Intergenic
1117749717 14:58908613-58908635 CTGGAGACTTGGAAGGGTGAGGG + Intergenic
1117921358 14:60728172-60728194 CTGGGGACTCCAAAAGGGGTGGG + Intergenic
1118010927 14:61609738-61609760 CTGGAGACACAGCAGAGGGAAGG - Intronic
1118586042 14:67354049-67354071 CTGGAGGCTGAGAAGGGTGAGGG - Intronic
1118918136 14:70125330-70125352 TTGGAGACTCGGAAGGGTGGGGG - Intronic
1119442096 14:74635372-74635394 CTAGAGAAGCAGATGGGGGTGGG - Intergenic
1120131716 14:80815941-80815963 CTGGAGACCCAGAGGGTGGGAGG + Intronic
1120139588 14:80913755-80913777 GTGGAGACTCAGAAGGGAGGAGG + Intronic
1120365268 14:83561156-83561178 CTTGAGAATCATATGGGGGTAGG + Intergenic
1120771644 14:88385945-88385967 CTGGCGACTCAGCCAGGGGTAGG - Intronic
1121741358 14:96254569-96254591 CAGGGGACTAAGAAGTGGGTAGG - Intronic
1121784124 14:96642275-96642297 CTGGAGACTGATAAGTGGGGTGG - Intergenic
1122246946 14:100410088-100410110 CTGGAAACTCAGATGGGGTTTGG - Intronic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122879514 14:104683847-104683869 CTGCAGACTCAGAAGAGGCAGGG - Intergenic
1124117713 15:26862915-26862937 CTGGAGACTTAGAAGGGAGAAGG + Intronic
1124964401 15:34422632-34422654 CCCCAGAGTCAGAAGGGGGTTGG + Intronic
1124981020 15:34568860-34568882 CCCCAGAGTCAGAAGGGGGTTGG + Intronic
1125552973 15:40561534-40561556 TTGGAGATTCAGAAGTGGGGAGG + Intronic
1125599150 15:40906260-40906282 CTGGAGGGCCAGAGGGGGGTGGG + Intergenic
1126304046 15:47234501-47234523 TTGGAGACTCAGGAAGGGGAAGG - Intronic
1126382147 15:48059960-48059982 CTGGAGTCTCAGGACGGGGAGGG - Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126549952 15:49917624-49917646 CTGGAGAATCAGATGGTGTTGGG + Intronic
1126573715 15:50177929-50177951 TTGGAAACTTTGAAGGGGGTAGG + Intronic
1126715864 15:51516795-51516817 TTAGAGACTCAGAAGAGGGAGGG - Intronic
1127449526 15:59103277-59103299 TTAGAGACTCAGAAGAGGGAGGG - Intergenic
1127453676 15:59139492-59139514 CTGCAGAGTAATAAGGGGGTGGG - Intronic
1127564679 15:60175640-60175662 CTGGGGACTCAGCAAGGTGTGGG + Intergenic
1127714545 15:61636719-61636741 TTGGGGACTCAGAAGGGAGGTGG + Intergenic
1128291721 15:66483237-66483259 CTGGAGTCACAGTGGGGGGTAGG - Intronic
1128646572 15:69383013-69383035 CTGGAGAATCACTAGGGGATTGG + Intronic
1129053174 15:72799184-72799206 CTGGAGAATGAGAAGGGGACAGG - Intergenic
1129113014 15:73349129-73349151 CTGGAGACCAGGAAGGAGGTGGG - Intronic
1129444443 15:75606918-75606940 CTGGAGAGAGATAAGGGGGTGGG + Intronic
1129722441 15:77885206-77885228 CTGGGGAGTCAGAGGGGGCTGGG + Intergenic
1130043073 15:80421240-80421262 TTGGAGACTCAGAAGGGTGGAGG + Intronic
1130106295 15:80931139-80931161 CCTGAGACCCAGAAGGAGGTGGG - Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130328899 15:82904344-82904366 CTGAAGACTCAGTGTGGGGTAGG + Intronic
1130361063 15:83186717-83186739 CTGGAGATTCAGAAGGGAAGAGG + Intronic
1130374418 15:83315522-83315544 TTGGAGACTCAGAAGCGGGGAGG + Intergenic
1130733740 15:86526839-86526861 TTGGAGAAACAGAAGGGGGTTGG + Intronic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1130995007 15:88898822-88898844 CCAGCGACACAGAAGGGGGTGGG - Exonic
1131299718 15:91186696-91186718 CTGGAGACTCAGAAGGCTGTGGG + Intronic
1131329377 15:91482519-91482541 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1131572089 15:93548780-93548802 TTGGAGACTCAGAAGGGTACAGG + Intergenic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133542090 16:6765962-6765984 TTGGAGACTCAGAAGATGGGAGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133886942 16:9838894-9838916 CTGGAGACTCAGAAAGGGAGAGG + Intronic
1134380914 16:13725097-13725119 TTGGAGACTCAGAAATGGGGAGG + Intergenic
1134740667 16:16540914-16540936 CTGGAGACTCAGAAGAGGAGAGG - Intergenic
1134926835 16:18171266-18171288 CTGGAGACTCAGAAGAGGAGAGG + Intergenic
1135194772 16:20385571-20385593 TTGGAGACTCAGATGCGGGGAGG + Intronic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135725949 16:24854004-24854026 CCGGAGACTCAGGAAGGGCTTGG + Intronic
1135799604 16:25480351-25480373 CTGGAAACTCAGAAAGGGAGGGG + Intergenic
1135831061 16:25773802-25773824 CGGGAGACTCAGAAGAGAGGAGG - Intronic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136004276 16:27317888-27317910 CTGGATACGCAGAAGGGACTCGG - Intronic
1136555994 16:31008238-31008260 CTGGAGATTCAAGAGGGGGCGGG - Intronic
1136582214 16:31159916-31159938 CTGGAGACCAAGAGGTGGGTGGG - Intergenic
1136651103 16:31672076-31672098 TTAGAGACTTAGAAGGGGGAGGG - Intergenic
1137565866 16:49532224-49532246 CTGGAGACTCTGACGGTGGGTGG + Intronic
1137634776 16:49976285-49976307 CTGGAGACAGGGACGGGGGTTGG + Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138057753 16:53853477-53853499 CTGGAGATTCAGAAGAGAGGAGG - Intronic
1138135128 16:54514855-54514877 CCGGAGACTTAGAAGGTGGATGG - Intergenic
1138212589 16:55175773-55175795 CTGCAGATTCAGGAGGGGATGGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138341265 16:56290521-56290543 CTGGAGACCCAGAATGAGTTTGG + Intronic
1138719673 16:59064883-59064905 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1138938956 16:61766146-61766168 TTGGAAACTCAGAAGGGGGTAGG - Intronic
1138966697 16:62093298-62093320 CTGGAGACTCCAAAAGGGGGAGG - Intergenic
1139023924 16:62789939-62789961 TGAGAGACTCAGAAGGGGGAGGG - Intergenic
1139305913 16:65986243-65986265 TTGGAGACTCAGAAGGGAAAAGG + Intergenic
1139316736 16:66078387-66078409 TTGCAGACTCAGAAGAGGGGAGG - Intergenic
1139620848 16:68140951-68140973 TTGTAGACTCAGAAGAGGGTAGG - Intronic
1140659629 16:77175435-77175457 TTGGAGACTCGGAAGAAGGTGGG + Intergenic
1140705238 16:77622657-77622679 TTGGAGACTGAGAAAGGGGAAGG - Intergenic
1141030387 16:80582631-80582653 TTAGAGACTCAGAAGGAGGAAGG + Intergenic
1141986396 16:87583007-87583029 TTGGAGGCTCAGGAGGAGGTGGG + Intergenic
1142018508 16:87765598-87765620 GTGGAGACTCAGGAGGGGGCGGG + Intronic
1143293124 17:5848113-5848135 CTGAAGACTCAGAAAGGAGGAGG - Intronic
1143674387 17:8421229-8421251 CTGGAAGATCAGAAAGGGGTAGG + Intronic
1144553214 17:16259807-16259829 CTGCCAACTCAGAAGGGAGTAGG - Intronic
1146085227 17:29822162-29822184 CTGGAGATGCTGAAGGGGATGGG - Intronic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146582354 17:34049953-34049975 CTGGAGACTCAGAAATAGTTGGG - Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1146636365 17:34508465-34508487 CTGGAGATTCAGATGTGGGGAGG - Intergenic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1149217096 17:54370216-54370238 CTGGGGAGTTAGAAGGGGGATGG + Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1150665319 17:67130165-67130187 CTGGAGATTCAGAAGGTAGCGGG + Intronic
1150913612 17:69413816-69413838 CCCGAAACTCAGTAGGGGGTAGG - Intergenic
1152140483 17:78533616-78533638 CTGGAGAATCCCAAGGTGGTCGG + Intronic
1152262415 17:79274221-79274243 CTGGAGACTGGGATGGGGGTTGG + Intronic
1152283518 17:79399137-79399159 CTGGAGTCTCAGAGGGGGCATGG + Intronic
1152430575 17:80246359-80246381 CAGGAGACTGAGCAGGGGCTGGG + Intronic
1152850639 17:82632633-82632655 TTGCAGACACAGAAGTGGGTGGG - Intronic
1152891562 17:82884508-82884530 CTGAAGACGCAGAAGAGAGTGGG + Intronic
1153110346 18:1579036-1579058 ATGGAGACTCAGAAGAGAATTGG - Intergenic
1153350835 18:4079521-4079543 CTGGAGACTCAGAAGTGGGGAGG + Intronic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153499597 18:5734651-5734673 CTGGAGACTCAGAAGGGTGGAGG + Intergenic
1153749492 18:8214096-8214118 TTGGAGACTCGGAGGGGGGCAGG + Intronic
1153909827 18:9696968-9696990 CTAGACACTGAGAAGGAGGTTGG - Intergenic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1154138898 18:11805513-11805535 CAGGAGACTCAAAAGGGTGAGGG - Intronic
1154214961 18:12408739-12408761 ATGGAGACTCTGAAGGGTGAGGG + Intronic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156422850 18:36974327-36974349 TTGGAGACTCAGAAGAGTGGAGG - Intronic
1156490916 18:37495523-37495545 CTGGAGCCTCAGATGGGGCATGG - Intronic
1157625308 18:49045786-49045808 CTGGAGGCTAAGGAGGGGGTGGG + Intronic
1158294312 18:55977936-55977958 TTGGAGATTCAGAAGGGAGGAGG + Intergenic
1158369557 18:56784434-56784456 ATGGAGACTCAGAAGGGGAAGGG - Intronic
1158547732 18:58410313-58410335 CTGTAAACTCAGAGGAGGGTTGG - Intergenic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158629297 18:59098388-59098410 CTGGAGGCTGAGAAGGGTATGGG + Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1158859440 18:61578030-61578052 GTGGACACTCAGAAGGGTGGAGG + Intergenic
1160213815 18:76908492-76908514 CTGGAGCCTCAGCATGTGGTGGG + Exonic
1160239427 18:77112559-77112581 CTGGAAACAGAGAAGGGGGAGGG - Intronic
1160331894 18:78001281-78001303 TTAGAGACTCAGAAGGGGAAGGG - Intergenic
1161081825 19:2314761-2314783 CAGGAGGCTGAGACGGGGGTGGG - Intronic
1161227734 19:3154971-3154993 CTGGAGACTGAGACGGGAGTGGG - Intronic
1161344288 19:3760222-3760244 CTGGAGGCCCCGAAGGGGATCGG + Exonic
1161530176 19:4784106-4784128 GTGGAGACTCAGAAGCGGGGAGG + Intergenic
1163090291 19:15014711-15014733 CAGGAGACTCAGTGGGGGGGCGG + Intronic
1163162716 19:15475151-15475173 GTGGAGATTCAGAAGGGTGAGGG + Intronic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163381941 19:16975008-16975030 TTGGAGATTCAGAAATGGGTTGG - Intronic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164901388 19:31928515-31928537 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1164944595 19:32282757-32282779 CTGGAGACTCAAAAGGGGAGAGG - Intergenic
1165230312 19:34382635-34382657 CTGGAGCCTGAGCAGGTGGTGGG + Intronic
1165510513 19:36264161-36264183 GTAGAGACACAGAAGGGGTTGGG + Intergenic
1165905070 19:39188808-39188830 CTGGAGTCTGAGAGAGGGGTCGG - Intergenic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166602117 19:44105674-44105696 ATGGAGACTCAAAATGGGGAGGG - Intronic
1166714897 19:44960723-44960745 CTGGAGCCTCAGAGGGAAGTGGG + Intronic
1166744388 19:45133684-45133706 CTGAAGTCTCATAAAGGGGTGGG - Intronic
1166864970 19:45830310-45830332 CTGGAGAGGCAGCAGGGGGATGG - Intronic
1167099214 19:47393759-47393781 GTAGAGACACAGAAGGGGTTGGG - Intergenic
1167484979 19:49757441-49757463 CTGAAGACTCAGAAGGTCTTGGG + Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167793385 19:51693966-51693988 ATGGAGACTCAGAGAGGGGGAGG + Intergenic
1168254725 19:55159145-55159167 CTGGAGACTCAGAGGGCAGCTGG + Exonic
1168327037 19:55543829-55543851 CTGGAGTCAATGAAGGGGGTGGG - Intronic
925144334 2:1570779-1570801 CTGGAGACTCAGAGGCGGGGAGG - Intergenic
925977283 2:9150141-9150163 CTGGAGGCCAAGAAGGGGGCTGG + Intergenic
926211960 2:10878013-10878035 TTGGAGGCTCAGCAGGGTGTGGG - Intergenic
926554433 2:14341267-14341289 CTGCCAACTCATAAGGGGGTGGG - Intergenic
926577544 2:14598706-14598728 CTGGAGACTCAGGAGATGGTAGG - Intergenic
926685933 2:15697532-15697554 TTGGAGACTCAGACTTGGGTGGG - Intronic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
927144662 2:20154947-20154969 TTGGAGTCTCAGAAAGAGGTGGG + Intergenic
928479676 2:31669264-31669286 TTTGAGACTCAGAATGGGGAGGG - Intergenic
928589923 2:32803519-32803541 CTGGGGAGACAGAAGTGGGTTGG - Intronic
928761110 2:34584081-34584103 TTGGAGACTGAGAAGTGGGAAGG + Intergenic
929871574 2:45763513-45763535 TTGGAGACTAGGGAGGGGGTGGG - Intronic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930528325 2:52559784-52559806 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
930539442 2:52686754-52686776 CTGGAGTCTCAGAATGGGGGAGG + Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
932072762 2:68637282-68637304 CTGGGGACTCAGAACGGTTTGGG - Intergenic
932875062 2:75442793-75442815 TTGGAGATTCAGAAGTGGGAAGG + Intergenic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933294827 2:80477515-80477537 ATGGAGACTCAGAATGGGAAAGG - Intronic
933458335 2:82545669-82545691 ATGGAGACTAAGAAGGGTGGAGG - Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934313182 2:91889265-91889287 TTGGGTTCTCAGAAGGGGGTTGG + Intergenic
934475135 2:94588556-94588578 CTGGAGGGTGAGAAGAGGGTGGG - Intronic
934484794 2:94695637-94695659 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
934894039 2:98097253-98097275 TTGGAGACTCAGAAGTGGGGAGG - Intronic
935081085 2:99795373-99795395 CTGGGGACTCAGAAGGGCAATGG + Intronic
935233543 2:101119366-101119388 CTCCTGAGTCAGAAGGGGGTGGG - Intronic
935476811 2:103532331-103532353 TTGGAGATTCAGAAGTGGGGAGG - Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936461324 2:112715545-112715567 CTGGGGGCTCAGAAGAAGGTGGG + Intergenic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
937971250 2:127551063-127551085 CTGCAGACTGAGGATGGGGTGGG + Intronic
937987059 2:127642676-127642698 CTTGAGACTCAGGAGGCGGGTGG - Intronic
938526005 2:132131705-132131727 CTGTAGACTCAGAAGGGTGAGGG - Intergenic
938930626 2:136083644-136083666 TTGGACACTCGGAAGGGGGCTGG - Intergenic
939027417 2:137030758-137030780 CTGGAGACTCAGAAATGGGGAGG + Intronic
939106173 2:137951166-137951188 TTGGAGACTCAGAAGTGGAAGGG - Intergenic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
940660857 2:156543585-156543607 CTGGAAACACAGAAGAGGGAAGG + Intronic
940694417 2:156960054-156960076 TTGCCAACTCAGAAGGGGGTGGG + Intergenic
941478886 2:165981826-165981848 CTGGAGATTCAGAAGTAGGGAGG - Intergenic
941887192 2:170540206-170540228 CTGCAGACTCCGAAGTAGGTGGG - Intronic
942941053 2:181618114-181618136 CAAGAGAGTGAGAAGGGGGTGGG + Intronic
942981130 2:182083408-182083430 TTGGAGACTCAGAAATGGGCAGG - Intronic
943332172 2:186572858-186572880 GAGGTGACTCAGAAGAGGGTGGG - Intergenic
943341359 2:186685736-186685758 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
944082401 2:195802859-195802881 GAGGAGACTCAGAAGGGTGAAGG - Intronic
944876359 2:203966767-203966789 GTAGAGACACAGAAGGGGTTGGG + Intergenic
945075774 2:206038066-206038088 ATGAAGACTCAGAAGGGTGACGG + Intronic
945327680 2:208501550-208501572 CTAGAGACTCAGAAAGGGGGAGG - Intronic
946096855 2:217281865-217281887 CTGGAGAGTCTGCAGGGGGCTGG + Intergenic
946150517 2:217764156-217764178 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
946986867 2:225283121-225283143 TTGGAGAAACAGAAGGTGGTGGG - Intergenic
947131508 2:226931477-226931499 TTTGAGACTCAGAAGGGGAAAGG + Intronic
947365261 2:229388028-229388050 CTTCAGACTCAGGAGGGAGTGGG + Intronic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
948302140 2:236915508-236915530 CAGGAAATTCAGAAGGAGGTTGG - Intergenic
948669853 2:239561306-239561328 CTGGAGACTCAGAAAGGAGGTGG - Intergenic
948907632 2:240987249-240987271 CTGGAGCCTGAGGAGGGGGAGGG + Intronic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169323214 20:4652615-4652637 ATGGAGACTCAGAAGTGGGGAGG - Intergenic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1170465120 20:16615768-16615790 CAGGAAACACTGAAGGGGGTTGG - Intergenic
1170809195 20:19660292-19660314 TTGGAGACTTAGAAGGTGGGGGG - Intronic
1170961891 20:21032835-21032857 TTGGAGACTCAGAGGTGGGGAGG + Intergenic
1171042073 20:21773917-21773939 CTGCAGACTCAGAAGGTGGGAGG - Intergenic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1171374537 20:24683374-24683396 CTGGAGACTCAGAACGGTGGGGG + Intergenic
1171778495 20:29394603-29394625 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1171822552 20:29867053-29867075 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1172056091 20:32155278-32155300 CTGGGGACTCAGAAAAGGGAAGG - Intronic
1172749952 20:37243819-37243841 CTGCAGACTCAGATGGGAGCTGG + Intergenic
1173032826 20:39378284-39378306 CTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173095884 20:40027792-40027814 TTGGGGACTCGGGAGGGGGTTGG - Intergenic
1173110187 20:40180097-40180119 CTGGAAAATCAAAAGGGGGTGGG - Intergenic
1173833775 20:46111589-46111611 CTGGAGACAGTGCAGGGGGTGGG + Intergenic
1174149532 20:48476361-48476383 CTGGAGACCCAGAAAGGAGTTGG - Intergenic
1174149601 20:48476760-48476782 CTGGAGACCCAGAAAGGAGCTGG - Intergenic
1174454893 20:50642004-50642026 CTGCGGAAGCAGAAGGGGGTGGG - Intronic
1174471909 20:50767726-50767748 CTGCGGAAGCAGAAGGGGGTGGG + Intergenic
1174785887 20:53432128-53432150 CTGGAGACTCAGAAGTGGGGAGG - Intronic
1175343785 20:58254523-58254545 CTGAAGACTCAGAAGGGGAGAGG + Intergenic
1175614703 20:60387407-60387429 CTAGAGACTGGGAAGGGGGAAGG + Intergenic
1175617556 20:60414020-60414042 CTTGAGAATCAGAAAGGGGGAGG - Intergenic
1175692961 20:61079279-61079301 CAGGAGGGTCAGGAGGGGGTGGG - Intergenic
1175948276 20:62568826-62568848 CTGGAGGCTCTGACTGGGGTAGG - Intronic
1176973407 21:15290685-15290707 CTGTCAACTGAGAAGGGGGTGGG + Intergenic
1177378921 21:20312538-20312560 CTGGAGACTTAGAAGGTGGGAGG + Intergenic
1177883849 21:26725004-26725026 ATGGAGACTTAGAAGTGGGGAGG - Intergenic
1178384524 21:32138435-32138457 ATGGGGATCCAGAAGGGGGTTGG - Intergenic
1179095916 21:38314340-38314362 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
1179313248 21:40215640-40215662 TTGGAGACTCAGAAGTGGGGAGG + Intronic
1179318350 21:40267012-40267034 CGGGAGACTCAGAAGTGGGGAGG + Intronic
1180073079 21:45448049-45448071 CAGGTGACTCAGCAGAGGGTGGG - Intronic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1180421076 22:12815506-12815528 CTAGAGACACAGGAGCGGGTAGG - Intergenic
1180435420 22:15298439-15298461 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1180539915 22:16435136-16435158 TTGGGTTCTCAGAAGGGGGTTGG + Intergenic
1181410350 22:22713958-22713980 CAGAAGATTCAGAAGGGAGTGGG - Intergenic
1181533417 22:23529964-23529986 CTGCATCCTCAGCAGGGGGTAGG - Intergenic
1182044564 22:27264188-27264210 GGGGAGCCACAGAAGGGGGTGGG + Intergenic
1182844372 22:33418397-33418419 CTGGATACTAGGATGGGGGTGGG + Intronic
1183398241 22:37585512-37585534 TTGGAGACTTAGCAGGGAGTGGG + Intergenic
1183597587 22:38821964-38821986 CTGGAGACTGAGGTGGGGCTGGG + Exonic
1183792849 22:40087776-40087798 CTGGAGACTGAGAGGGAGGCAGG + Intronic
1184410145 22:44321686-44321708 CTGCTTCCTCAGAAGGGGGTGGG - Intergenic
1184477331 22:44728827-44728849 CTGGAGGCTGAGAAGGGGCAGGG - Intronic
1184697831 22:46149975-46149997 CTTGAGGCTCAGAAGTGCGTAGG - Intergenic
1184809559 22:46821853-46821875 CTGGAGTACCAGAAGGGGATGGG - Intronic
949249815 3:1970368-1970390 CAGGAGACTGAGTTGGGGGTTGG - Intergenic
949827209 3:8177910-8177932 GTAGAGACACAGAAGGGGTTGGG - Intergenic
950199374 3:11032291-11032313 CTGGAGACTCAGAAGGGTGGGGG - Intronic
950214945 3:11152782-11152804 CTGGAGAATCACCAGGGAGTGGG + Intronic
951438519 3:22693951-22693973 TTGGAGACTCGGAAAGGGGATGG - Intergenic
951514730 3:23545989-23546011 TTGGAGACTCAGAAGAGAGGAGG + Intronic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952493147 3:33891235-33891257 TTGGAGACTCAGAAGAGAGAGGG - Intergenic
952641651 3:35603800-35603822 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
952643374 3:35625390-35625412 TTGGAGACTCAGAAGTGGGATGG - Intergenic
952896750 3:38082687-38082709 GTAGAGACTCAGAAGGGGTTGGG + Intronic
953235698 3:41104197-41104219 CTGGGGACACAGAAAGGGGCGGG + Intergenic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953289716 3:41649345-41649367 CTGCTGACTCAGTAGGGGGTGGG - Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
954517205 3:51189418-51189440 TTAGAGACTCAGAAAGGGGAGGG - Intronic
955032548 3:55234811-55234833 TTGGAGACTCAGGAGGGGGATGG - Intergenic
955457561 3:59140617-59140639 CTGGAGACTCAGGAGTGGGGAGG + Intergenic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956390830 3:68771106-68771128 ATGGGGAGTCAGAAGGGGGATGG - Intronic
956553012 3:70482958-70482980 CTGGAGAATGAGAAAGGGGCTGG + Intergenic
956724457 3:72145750-72145772 CTGGAGAGTGGGAAGGGGGTAGG - Intergenic
956856093 3:73276273-73276295 TTGGAGACTCAGAAGTAGGCTGG - Intergenic
957771681 3:84701413-84701435 ATGAAGACTCAGAAGGGTGTGGG + Intergenic
957876606 3:86155011-86155033 CTGGATCCTCAGCAGGGAGTAGG - Intergenic
958665176 3:97128014-97128036 CCGGAGACTCAGAAGTGGGGAGG - Intronic
958811821 3:98868610-98868632 TCGGAGACTCAGAAAGGGGGAGG - Intronic
958986471 3:100784868-100784890 TTAGAGACCCAGAAGGGGGAGGG + Intronic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
959352290 3:105281090-105281112 TTGGAGGCTCAGAAGGATGTGGG + Intergenic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960752283 3:120968711-120968733 TTGGATACTCAGAACGGGGGAGG - Intronic
960840883 3:121957436-121957458 TTGGAGTCTCAGAAGGGGATAGG + Intergenic
961817496 3:129558813-129558835 CTGGAGGCTCAGGAGGGGGTTGG - Intronic
961820612 3:129573867-129573889 CTGGAGGCTCAGGTGGGGCTGGG + Intronic
961943103 3:130657161-130657183 CTGCCAACTCAGAAGCGGGTGGG + Intronic
961994431 3:131226664-131226686 TTGGAGACTCAGAAGGGAGGAGG + Intronic
962174115 3:133134781-133134803 CTACAGACTCAGAAGCGGGGAGG - Intronic
962870463 3:139486151-139486173 CTTGAGACTCAGAAATGGGGAGG - Intergenic
963106473 3:141651847-141651869 CTGGAGACTCAGAGAAGAGTGGG + Intergenic
963806660 3:149729337-149729359 CTGGTGACTCAGCTGGGGGCAGG + Intronic
964214331 3:154262778-154262800 CTGGGGAATCACAAGGGGTTGGG + Intergenic
964629423 3:158794085-158794107 GTAGAGACTCAGAAGGGTGAAGG - Intronic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
964927387 3:161975448-161975470 CTGCCAACTCAGAAGGGGGTAGG + Intergenic
965697689 3:171426665-171426687 CTGGAGACTCTGGAGAGGATGGG - Intronic
965802952 3:172513222-172513244 CTGGAGACTGAGGAGAGGGCTGG - Intronic
967081026 3:186049597-186049619 CTGGAGACGCAGAGGGGGAAGGG + Intronic
967224158 3:187275063-187275085 CTGGAGTCCCAGAAGGGGTGAGG - Intronic
967331154 3:188290986-188291008 CTGTAGCATCAGAAGGAGGTGGG + Intronic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968857548 4:3138394-3138416 TTGGAGACTCACAAGGCGGAAGG - Intronic
969144618 4:5111600-5111622 CTGGAGACTTCAAAAGGGGTTGG + Intronic
969166739 4:5322641-5322663 CTGGAGACTAAGAAAGGTCTAGG + Intronic
969405212 4:6987116-6987138 CTGGAGACTCCCAAGGGGGCGGG - Intronic
969455481 4:7297523-7297545 AGGGAGACTCAGCAGGGGGCAGG - Intronic
969897174 4:10316274-10316296 TTGGAGACTCAGAAGGGTCATGG - Intergenic
970165722 4:13235849-13235871 TTGGAGACTCAGAAAAGGGGAGG + Intergenic
970221422 4:13815836-13815858 ATGGAGACTCAGAAGGGTGTGGG - Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970432598 4:16002449-16002471 AAGGAGCCTCAGAAGGGTGTGGG + Intronic
971265426 4:25092525-25092547 CTGGAGAATCAGAAGAGGTCGGG - Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
971709436 4:30092757-30092779 CTGGAGTTTCAGATGGGCGTGGG + Intergenic
971975679 4:33683311-33683333 TTGGAGACTCAGAATGGGGGAGG - Intergenic
972213191 4:36863235-36863257 TTGGAGACTCAGACGGGGAGAGG + Intergenic
972390251 4:38607010-38607032 ATGGGGAGTCAGAAGGGGGATGG + Intergenic
972446038 4:39144713-39144735 CTGGAGACTCAGAAATGGGGAGG - Intergenic
972889456 4:43538363-43538385 CTGGAGATTCAGAAAGGGAGAGG + Intergenic
973192408 4:47400727-47400749 TTGGAGACTCAGAAGTGGGGAGG - Intronic
973695061 4:53482688-53482710 TTGGAGACTCAGAAAAGGGGAGG + Intronic
973712855 4:53646358-53646380 ATAGAGACTGAGAATGGGGTGGG - Intronic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
975224054 4:71849045-71849067 CTGAAGAGACAGAAGGGAGTGGG - Intergenic
975290482 4:72672115-72672137 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
975437445 4:74369307-74369329 TTAGAGACTCAGAAGGGGAAGGG - Intronic
975457730 4:74612360-74612382 CTGGAGGCTGGGAAGGGTGTGGG + Intergenic
975802647 4:78077597-78077619 ATGGAGACTCGGAAGGGTGTGGG - Intronic
975905354 4:79204716-79204738 CTGGAGACTCAGAAGGGGAGTGG - Intergenic
976171927 4:82313263-82313285 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
976277553 4:83292845-83292867 TTGGAGACTCAGAAGGGAAGAGG + Exonic
977198948 4:94092490-94092512 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
977509533 4:97945214-97945236 TTGGAGACTTAGAAAGGGGAGGG - Intronic
977608358 4:99005905-99005927 TTGGAGACTCAGAAAGGGGGAGG + Intronic
977707636 4:100088998-100089020 CTGGAGACTCAGAACGGGAAGGG - Intergenic
977814002 4:101392265-101392287 TTAGAGACTCAGAAGTGGGGAGG + Intergenic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
978149480 4:105415647-105415669 CTGCCAACTCGGAAGGGGGTGGG + Intronic
978383564 4:108156838-108156860 GTAGAGACTCAGAAGGGTGAGGG + Intronic
978498335 4:109384038-109384060 CTGCCAACACAGAAGGGGGTGGG - Intergenic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
979281463 4:118872827-118872849 ATGGAGACTCAAAAGGGGGAGGG - Intronic
979325953 4:119379719-119379741 TGGGAGACTCAGAAGTGGGGAGG - Intergenic
979663850 4:123289172-123289194 CTGGAGATTCAGAACGGGGTAGG - Intronic
980378769 4:131982129-131982151 TTGGAGACTCAGATGTGGGGAGG - Intergenic
980544665 4:134244145-134244167 CTGCCAACTCAGAAGGGGGCGGG - Intergenic
980747638 4:137040303-137040325 TTGGAAACTCAGAATGGGGGAGG - Intergenic
980775995 4:137437245-137437267 CAGGAGACTCAGAAGGCTATTGG + Intergenic
980963800 4:139501419-139501441 TCAGAGACTCAGAAGGGGGAGGG + Intronic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981372326 4:143973046-143973068 TTGGAGACTCAGAAGCGGGAGGG - Intergenic
981381410 4:144076245-144076267 TTGGAGACTCAGAAGCGGGTGGG - Intergenic
981442782 4:144801849-144801871 TTGGAGATTCAGAAGAGGGGAGG - Intergenic
981738491 4:147977815-147977837 CTGGAGACTCCAAAAGGGGAGGG - Intronic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
981904118 4:149901004-149901026 CTAGCGACTCAGTAGGGGGAGGG + Intergenic
981912749 4:150000739-150000761 CTGGAAAAGCAGAATGGGGTAGG - Intergenic
981923287 4:150110639-150110661 TTAGAGACTCAGAAGTGGGGAGG - Intronic
981954602 4:150454737-150454759 TTGGAGACTTAGAAGGGAGAAGG - Intronic
982039455 4:151381337-151381359 TTGGAGACTCAGAAGGGTATAGG + Intergenic
982188387 4:152826458-152826480 TTGGAGACTCAGAAGAGGGGAGG + Intronic
982431777 4:155330889-155330911 TTGGAGACTCAGAAAGGTGGAGG + Intergenic
982610919 4:157574272-157574294 CTGCTGACTCAGAAGGGAGTGGG - Intergenic
982765029 4:159336328-159336350 TTGGAGACTCAGAAGGGGAAGGG - Intronic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983243812 4:165264376-165264398 TGGGAGACTCAGAAGTGGGGAGG - Intronic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
983511144 4:168610706-168610728 TTGGAGAGCCAGAAGGTGGTTGG - Intronic
984269542 4:177534208-177534230 CTGGAGAAGCAGGAGGGAGTAGG + Intergenic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
985042839 4:185909366-185909388 TTGGAGACTCAGAAGGGCTAGGG + Intronic
985233608 4:187848957-187848979 CTGGAGGCTCAGAGAGGGGCAGG - Intergenic
985481063 5:111258-111280 CTGCAGACTGAGAATTGGGTAGG - Intergenic
985717014 5:1468346-1468368 CTGGAGCCTCAGAACGGGCCGGG + Intronic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
986328175 5:6696097-6696119 TTGAAGACTCAGAAGTGGGGAGG - Intergenic
986435845 5:7730038-7730060 ATGGAGACTCCAAAGGGGGAAGG - Intronic
986539946 5:8834415-8834437 CTGGAGACTCAGAACAGGGAAGG + Intergenic
986645283 5:9910893-9910915 CTGGAGACTCTGGAGGGAATCGG + Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
986879008 5:12147283-12147305 TTGAAGACTCAGAAGGGTGGGGG - Intergenic
987223576 5:15816476-15816498 TTGAAGACTCAGAAGTGGGGAGG + Intronic
987537604 5:19208553-19208575 CTGCCAACTCAGTAGGGGGTGGG - Intergenic
987659226 5:20850924-20850946 CTAGAGACTCAGAAGCGAGGAGG + Intergenic
988065697 5:26227422-26227444 CTGGAGACCCAGAGGGGAGCTGG - Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988222331 5:28364241-28364263 ATGGAGACTCAGAAGGGTAGGGG + Intergenic
988348539 5:30070644-30070666 TTGGAGGCTCAGAAGTGGGGAGG - Intergenic
988764444 5:34355057-34355079 CTAGAGACTCAGAAGCGAGGAGG - Intergenic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
988889025 5:35594338-35594360 TTAGAGACTCAGAATGGGGAGGG - Intergenic
989407748 5:41080303-41080325 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
989443432 5:41500411-41500433 ATGGATACTCAGAAGGGTGAGGG + Intronic
989534024 5:42542788-42542810 CTGGAGACTGAGGAGGGGGTAGG - Intronic
989607539 5:43258928-43258950 TTGGAGACTTAGAAGGGGTAGGG - Intronic
991264545 5:64701522-64701544 CTGGAGTTTTAGAAGGGGCTGGG + Intronic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992276388 5:75124803-75124825 CTGGAGACTCAGAAGGGTAGGGG + Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
993165064 5:84342401-84342423 ATGGAGACTCAGAAAGGTGGGGG + Intronic
993195709 5:84742544-84742566 TTGGAGACTCAAAAGTGGGGAGG - Intergenic
993322757 5:86494319-86494341 CTGGACACTTAGAAGGGTGGAGG - Intergenic
993423669 5:87734645-87734667 CTGGAAACTGAGAAAAGGGTTGG + Intergenic
993540051 5:89138136-89138158 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
993741879 5:91551480-91551502 GTGGAGACTTGGAAGGGTGTGGG + Intergenic
993752044 5:91682238-91682260 CCAGAGGCTGAGAAGGGGGTGGG + Intergenic
994051494 5:95367173-95367195 CTGGAGACTAGGAAGGTGGTGGG - Intergenic
994228350 5:97281788-97281810 ATGGAGACTCAGATGGGGGCAGG - Intergenic
994313544 5:98305497-98305519 TTGAAGACTCAGAAGTGGGAAGG + Intergenic
994388675 5:99163524-99163546 TTGGAGACTCAGAAATGGGAAGG + Intergenic
995076340 5:107989290-107989312 CCAGAGACTGGGAAGGGGGTAGG - Intronic
996620413 5:125495036-125495058 TTAGAGACTCAGAAGGGGAAGGG + Intergenic
997089896 5:130844438-130844460 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
997892761 5:137689658-137689680 CTGGGGACTCCAAAGGGAGTGGG + Intronic
997979205 5:138458656-138458678 CTGCACACTCAGCTGGGGGTAGG + Intergenic
998446733 5:142204645-142204667 CTGGAGACACAGTGTGGGGTTGG - Intergenic
999195002 5:149775819-149775841 GTGGAGAAAGAGAAGGGGGTAGG - Intronic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
999923577 5:156350069-156350091 TTGGAGACTCAGAAGAGGAGAGG + Intronic
1000441347 5:161267432-161267454 TTGGAGACTCAGAAGTGAGGAGG + Intergenic
1000606763 5:163335214-163335236 GTGGAGACACGGGAGGGGGTGGG - Intergenic
1000641073 5:163702265-163702287 TTAGAGACTCAGAAGGGTGAAGG - Intergenic
1000821004 5:165983167-165983189 TTGGAGACTCTGAATGGGGGAGG + Intergenic
1001161277 5:169317352-169317374 CTGGAGACTCGGAAGGGTCCAGG + Intergenic
1001166415 5:169373297-169373319 TTGGAGACTAAGAAGTGGGGAGG + Intergenic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001260860 5:170227389-170227411 ATGGAAACACAGAAGGGGCTGGG + Intergenic
1001636125 5:173211551-173211573 CTGGAGGCTGAGAAGGGGCCGGG + Intergenic
1001759877 5:174198602-174198624 CTGGAGAGACCCAAGGGGGTAGG + Intronic
1001760882 5:174207150-174207172 TTGGAAACTCAAAAGGGGGAGGG + Intronic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1002996931 6:2295278-2295300 TTGGAGACTGACAAGGGGGAGGG + Intergenic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004464029 6:15866776-15866798 CTGGAGCCTCAGAGGGTGTTGGG - Intergenic
1004984079 6:21059917-21059939 GTGAAGACTCAGAAGGGGGAGGG - Intronic
1004985277 6:21074974-21074996 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1005046771 6:21650684-21650706 ATGGAGACACAGCAGGGGGTGGG + Intergenic
1005394866 6:25370920-25370942 TTGGTGACTCAGAAGAGGGGAGG - Intronic
1006135443 6:31892973-31892995 CTGGAGCCCCAGGCGGGGGTGGG + Intronic
1006180670 6:32151765-32151787 CTGGAGACAGTGGAGGGGGTGGG + Intronic
1006241288 6:32681328-32681350 TTGGAGACTCAGAAGAGGGGAGG - Intergenic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1006664343 6:35679758-35679780 CTAGAGACTCAGAAGAGGGCAGG + Intronic
1007040357 6:38715747-38715769 TCGGAGACTCAGAAGGGGAAGGG + Intronic
1007602305 6:43090148-43090170 CTGGTGACCCAGAAAGGGGTAGG + Intronic
1008595277 6:53035785-53035807 CTGCTGACTCAGAAGGGGAAGGG - Intronic
1009030440 6:58050970-58050992 CTAGAGGCTGAGAAGGGTGTGGG - Intergenic
1009205972 6:60802138-60802160 CTAGAGGCTGAGAAGGGTGTGGG - Intergenic
1009271374 6:61619262-61619284 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1009278340 6:61714881-61714903 ATGGAGACTCAGAAGAGTGGGGG + Intronic
1009514503 6:64597694-64597716 CTGGAGACTTAAAAGGGTGGGGG + Intronic
1009624394 6:66120542-66120564 TTGGAAACTCAGAAGGGGATAGG - Intergenic
1009709998 6:67305925-67305947 CTGGAGACTCAGAAAGGAGGAGG - Intergenic
1011066527 6:83332742-83332764 CTGGAGACTCAGATGGGAGGAGG + Intronic
1011308188 6:85952511-85952533 CGGGAGACACAGAAGGGGAAGGG - Intergenic
1011505860 6:88043211-88043233 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1012029560 6:94041066-94041088 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1012351813 6:98260744-98260766 CTGGAGATTCAGAAGTGAGGAGG - Intergenic
1012700028 6:102444390-102444412 TTGGAGACTCACAAGGGAGGAGG - Intergenic
1012729698 6:102866682-102866704 TTGGAGACTCAAAAGGGGAAAGG + Intergenic
1012830572 6:104199518-104199540 TTGGAAACTCAGGAGGGGGTAGG + Intergenic
1012902344 6:105020708-105020730 ATAGAGACTCAGAAGGGTGAGGG - Intronic
1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG + Intronic
1013508649 6:110824407-110824429 CTGGAGACTCAGAAAAGGGAGGG + Intronic
1013847534 6:114471938-114471960 CTGGAGAGACAGAAGCTGGTAGG - Intergenic
1013858448 6:114604544-114604566 TTGGAGTCTCAGAAGTGGGGAGG + Intergenic
1013895116 6:115078717-115078739 CTGGAGCCAGAGAAGGGAGTGGG + Intergenic
1014069661 6:117166891-117166913 CTGGAGACACAGAAGAGAGGTGG - Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014393648 6:120896133-120896155 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1014545581 6:122731573-122731595 TTGGAGACTTGGAAGCGGGTGGG + Intergenic
1014700267 6:124678036-124678058 CTTGCAACTCAGAAGGGAGTGGG - Intronic
1014850905 6:126338625-126338647 CTGGAGATTGAGAATGGGGTAGG + Intergenic
1015151029 6:130037934-130037956 CTAGAGGCTAGGAAGGGGGTGGG - Intronic
1015607757 6:134976738-134976760 CTGGAGACTCAGTAGCGGGTAGG + Intronic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016088326 6:139943586-139943608 CATCAGAATCAGAAGGGGGTGGG + Intergenic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1016469082 6:144356074-144356096 CTGGAACCTCAAAAGGGGGAAGG + Intronic
1016689563 6:146921169-146921191 CTGGAAACTCAGAAGGGAGCGGG + Intergenic
1016693040 6:146961360-146961382 CTGGAGACTCAGAAGGGTAAGGG + Intergenic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017587830 6:155946887-155946909 CTGCCAACTCAGTAGGGGGTGGG - Intergenic
1017938360 6:159027334-159027356 TTGGAGACTCAGAATGGGGGAGG + Intergenic
1018049108 6:159992370-159992392 CTGGAGACTCAGAAAGGTTGGGG - Intronic
1018354774 6:163001152-163001174 CTGAAGACTCTGAAATGGGTGGG + Intronic
1019098440 6:169607612-169607634 CTGGAGACTCAGAAGGGTAGAGG + Intronic
1019098861 6:169610880-169610902 TTGGAGACTCACAAGGGGGCAGG + Intronic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1019892729 7:3959572-3959594 ATGGGGACTCACAAGGGTGTGGG - Intronic
1019978215 7:4601483-4601505 CTGGAGACTCTGAAGGGTGGGGG + Intergenic
1020560981 7:9728341-9728363 TTGGAGATTCAGAAATGGGTTGG + Intergenic
1020637508 7:10714322-10714344 CTCGAAACTCAGAAGGTGGTGGG - Intergenic
1020966944 7:14882596-14882618 ATAGAGACTCAGAAGGGAGAAGG - Intronic
1021008709 7:15434865-15434887 CTAGGGACTGAGAATGGGGTGGG - Intronic
1021466500 7:20949987-20950009 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
1021873132 7:25023194-25023216 TTGGAGACTCTGAAGGGGGAGGG - Intergenic
1022354165 7:29596281-29596303 CTGAAGACTCAGAAGTGGGGAGG + Intergenic
1023529408 7:41136986-41137008 CTGTCAACTCGGAAGGGGGTGGG + Intergenic
1024272458 7:47652864-47652886 AGGGAGACTCAGAAGGGTGGAGG + Intergenic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1024979719 7:55147080-55147102 CTGGAGACTCAGAAGCATGTAGG - Intronic
1024991070 7:55234819-55234841 CAGGAGACAGAGGAGGGGGTTGG + Intronic
1026070995 7:67119483-67119505 CCGAAGACTCAGAAGGGAGAAGG - Intronic
1027303817 7:76870697-76870719 TTAAAGACTCAGAAAGGGGTGGG + Intergenic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1027528723 7:79303145-79303167 TTGGAGACTCAGAGGGTGGAAGG + Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027823996 7:83087287-83087309 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028607593 7:92671969-92671991 TTGGAGACTCAGAAAGGGGGAGG + Intronic
1028967498 7:96818269-96818291 TTGGAGACTCAGAAGAGGGGTGG - Intergenic
1029618479 7:101675116-101675138 CTGGATGTGCAGAAGGGGGTCGG - Intergenic
1029805036 7:102987139-102987161 CTGGAGACTCTGAAAGGGAGAGG + Intronic
1029928469 7:104344418-104344440 TTGGAGATTCAGAAGGGGAAGGG - Intronic
1030145755 7:106353161-106353183 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1030656524 7:112174049-112174071 GTGGAGACTCAGGAGGGAATTGG - Intronic
1030991544 7:116307143-116307165 ATGGAGACTTAGAAGGGTGATGG + Intronic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1031238501 7:119209189-119209211 GTGGAGACTTAGAAGAGGGTGGG + Intergenic
1031656608 7:124363917-124363939 TTAGAGACTCATAAGGGGGAGGG - Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031786427 7:126040308-126040330 CTGCTGATTCAGAAGGGGGCAGG - Intergenic
1032990263 7:137386686-137386708 CTGGGGACACAGAAAAGGGTAGG + Intronic
1033673997 7:143519772-143519794 CTGGAGACCTAGGAGGGGCTTGG + Intergenic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1034071701 7:148192259-148192281 GTGGAGACTCAGAAGGGTGTAGG - Intronic
1034300813 7:150013843-150013865 CCAGAGACTCAGAGGTGGGTAGG + Intergenic
1034805238 7:154083457-154083479 CCAGAGACTCAGAGGTGGGTAGG - Intronic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1035124792 7:156600739-156600761 CTGGAGCCTCGGAAGGGCGGGGG + Intergenic
1035130414 7:156647352-156647374 TTGGAGACTCAGGAGGCGGAGGG - Intronic
1035138666 7:156734479-156734501 ATGGAGAGTCAGAAGGGAGAGGG + Intronic
1035343219 7:158178354-158178376 TTGGAGACTCAGAAGCGGGAGGG - Intronic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036658172 8:10691015-10691037 CTGGTGACTCAGAAAGTGGAGGG - Intronic
1036907506 8:12719919-12719941 CTGCCAACTCAGTAGGGGGTGGG - Intergenic
1036986961 8:13543828-13543850 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1037586869 8:20283016-20283038 CTGGGGGCTCAGAAGTGGGATGG + Intronic
1037808364 8:22070824-22070846 ATGGCAACTCAGAAGGGTGTGGG - Intronic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038714677 8:29981089-29981111 CTGGAGATTCTGAGGGGGCTGGG + Intergenic
1038779211 8:30556504-30556526 CAGGAGACACAGGAGGGGGAGGG - Intronic
1038908017 8:31928854-31928876 TTGGAGACTAAGAAGCGGGGAGG + Intronic
1038932233 8:32206791-32206813 CTGGAGACTCAGAAGGGTGGAGG - Intronic
1039098347 8:33911922-33911944 ATGAAGACTCAGAAGGGTGAGGG + Intergenic
1039208294 8:35182250-35182272 TTGCAGACTCAGAATGGGGGAGG + Intergenic
1039241746 8:35564751-35564773 CTGGATTCTCAGAAGTGGGGAGG - Intronic
1039380443 8:37079941-37079963 CTGAAGAGTCAGAATGGGGCGGG + Intergenic
1039781994 8:40794957-40794979 CTGGAAGCTCAGAAGAGGGAGGG + Intronic
1039897772 8:41728404-41728426 CTGAAGACTCAGAGGGTGGGAGG + Intronic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040719859 8:50306051-50306073 TTAGAGACTCAGAAGGGGGAGGG - Intronic
1041080177 8:54208245-54208267 CTGGAGAGGCAGTAGGGGTTAGG + Intergenic
1041319254 8:56596363-56596385 TAGGAGACTCAGAAGGTGGGAGG - Intergenic
1041893551 8:62898545-62898567 TTGGAGACTCAGAAGGGAGGAGG + Intronic
1041937351 8:63348477-63348499 TTGGAGACTCAGAAGAGGCAAGG - Intergenic
1042113431 8:65405862-65405884 GTGGAGAGTGAGATGGGGGTGGG + Intergenic
1042179067 8:66066709-66066731 TCGGAGACTCAGAAGGGGGAGGG + Intronic
1042267219 8:66921237-66921259 TTGGAGAATTAGAAGGGGGTGGG + Exonic
1042482737 8:69322568-69322590 CTGGAGACCCAGAAAGGAGCTGG + Intergenic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1042999194 8:74736582-74736604 CTTGAGTCTCAGAATGGGGCTGG + Intronic
1043074665 8:75683186-75683208 TTGGAGAGTCAGAAGCGGGGAGG - Intergenic
1043082684 8:75785180-75785202 CTATAAACTCAGAAAGGGGTGGG + Intergenic
1043355621 8:79408858-79408880 TTGGAGACTCAGAAGGGGAGAGG - Intergenic
1043366521 8:79539454-79539476 TTGGAGACTCAGAAGGGTAGTGG - Intergenic
1043367596 8:79553275-79553297 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1043666759 8:82825169-82825191 CCTGAGAGTCAGTAGGGGGTGGG - Intergenic
1043736315 8:83749771-83749793 TTGGAGACTCAGAAGGGTAAAGG - Intergenic
1044735301 8:95272502-95272524 CTGGAGACTCAGAAGAGAGGAGG - Intergenic
1044879529 8:96709252-96709274 TTGGAGACTCAGAAGCGGAGAGG - Intronic
1044918700 8:97145189-97145211 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1046232951 8:111381475-111381497 TTGGAGACTCAGAAGGGGGCAGG - Intergenic
1046730569 8:117721263-117721285 TTGGAGACTCAGAAGGGTTGGGG - Intergenic
1046777957 8:118183832-118183854 CTTGAGATTCAGAAGGCGGGAGG - Intergenic
1046825875 8:118690799-118690821 TTGGAGTCTCAGAAGTGGGGAGG - Intergenic
1046846551 8:118922476-118922498 CTGGAGCCTCTGTAGGGAGTGGG - Intergenic
1046873027 8:119224698-119224720 TTGGAGACTCAGGAGTGGGTGGG - Intronic
1046927890 8:119812478-119812500 TTGGAGACTCAGAAGCGGGGAGG - Intronic
1046975836 8:120276345-120276367 TTGGAGACTCAGAGTGGGGAGGG + Intronic
1047022640 8:120792333-120792355 TTGGAGACTCAGAAAAGGGGAGG + Intronic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047345547 8:124024357-124024379 CTGAAAACTCAGAAAGGGGGAGG - Intronic
1047537346 8:125731957-125731979 CTGGAGACGGAGACGGGGGAGGG + Intergenic
1047560282 8:125979963-125979985 CTGGAGACTCAGAATTTGGGAGG + Intergenic
1047607532 8:126489862-126489884 CTGCAGACTCAGAAGAGACTTGG - Intergenic
1047899866 8:129408413-129408435 CTGGAGATTCAGAAGGGTTGGGG - Intergenic
1048714330 8:137251155-137251177 AGGGAGACTCAGAAGGGTGCAGG + Intergenic
1049825863 8:144667385-144667407 CTGGAGATTGGGAAGGGGGTGGG - Intergenic
1050475621 9:6037824-6037846 TTGGAGACTCAGAAGAATGTAGG - Intergenic
1051012558 9:12436252-12436274 CAAAAGACTCAGAAGGGGGAAGG - Intergenic
1051112077 9:13650755-13650777 CTGGAGCCTGTCAAGGGGGTGGG - Intergenic
1052061726 9:23967732-23967754 CTGGAGACTCAGAGGATGGGAGG - Intergenic
1052434766 9:28412097-28412119 CTGGAGAATCAGAAGAGGGGAGG - Intronic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052599408 9:30605285-30605307 CTGGAGACTGAGAAGCAGGGAGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052825526 9:33171302-33171324 CTGGAAACTCAGAATGGGTTGGG + Intergenic
1052854915 9:33401206-33401228 CTGGAGGGTGAGAAGAGGGTGGG + Intronic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053475498 9:38379335-38379357 CTGGAGCCTCAGAAAGGAGCAGG + Intergenic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053525064 9:38820818-38820840 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1053672999 9:40388733-40388755 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1053682937 9:40497535-40497557 CTGGAGGGTGAGAAGAGGGTGGG + Intergenic
1053750139 9:41245072-41245094 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1053922809 9:43015102-43015124 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1053932918 9:43125849-43125871 CTGGAGGGTGAGAAGAGGGTGGG + Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054197295 9:62045240-62045262 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054255638 9:62809411-62809433 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1054280777 9:63127393-63127415 CTGGAGGGTGAGAAGAGGGTGGG - Intergenic
1054335673 9:63806196-63806218 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1054384108 9:64528799-64528821 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054394053 9:64637530-64637552 CTGGAGGGTGAGAAGAGGGTGGG + Intergenic
1054501677 9:65878800-65878822 CTGGAGGGTGAGAAGAGGGTGGG - Intronic
1054511626 9:65987550-65987572 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054641114 9:67543442-67543464 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1054880347 9:70138061-70138083 GTGGAGACTTAGAAGGGTGAGGG - Intronic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1056281703 9:85047846-85047868 TTGGATACTCAGAAAGGGGGAGG - Intergenic
1057742076 9:97720658-97720680 CTAGAGCCTCAGGAGGGAGTAGG + Intergenic
1057836673 9:98451071-98451093 ACTGAGACTCAGAAAGGGGTGGG - Intronic
1057977146 9:99618137-99618159 CTGGAGACTCAGAAGAGTAGGGG + Intergenic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1058276494 9:103048039-103048061 TTAGAGAATCAGAAGGGGGAGGG + Intergenic
1058348043 9:103988003-103988025 TTGGAGACTCAGAAGTAGGTAGG + Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058660586 9:107263866-107263888 CTGGAGATTCATATGGGTGTTGG + Intergenic
1059093493 9:111386983-111387005 CTGCAGACCCTCAAGGGGGTCGG + Intronic
1059269127 9:113061204-113061226 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059270263 9:113066653-113066675 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059271399 9:113072103-113072125 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059272530 9:113077547-113077569 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059273665 9:113082989-113083011 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059274801 9:113088435-113088457 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059643904 9:116245144-116245166 ATGGACACTCAGAAGGGTGGGGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059973528 9:119692108-119692130 CTGGGGACTCAGAAGAGGAGAGG - Intergenic
1060333448 9:122698167-122698189 TTGGAGACTCCGAAGTGGGAAGG + Intergenic
1061553003 9:131348880-131348902 CTGGAGACTTACAGAGGGGTGGG + Intergenic
1061930852 9:133832378-133832400 CTGCAGACTCTGCTGGGGGTTGG + Intronic
1061938529 9:133871878-133871900 CTGGGGGCTCAGAAGGGGCAGGG - Intronic
1062562095 9:137146247-137146269 CTGGGGACTCAGGACAGGGTGGG - Intronic
1062604110 9:137336124-137336146 CTGGAGGCTCAGAGGTGGGGAGG + Intronic
1203371924 Un_KI270442v1:315169-315191 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1185504707 X:623893-623915 CTGGAGACGCAGGCGGGGCTGGG - Intergenic
1185859566 X:3564982-3565004 TTGGAGACTCCGAAGTGGGAGGG + Intergenic
1185926441 X:4152321-4152343 TTGGACACTCAGAAGGGGGAGGG - Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186122544 X:6379589-6379611 CTGGAGACTCAGAAGTTGGGAGG - Intergenic
1186570494 X:10710161-10710183 CAGGAAATTCAGATGGGGGTTGG + Intronic
1186826308 X:13343548-13343570 TTGGAGACTCAGAAGGGAGGAGG - Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187100098 X:16183395-16183417 GTAGAGACACAGAAGGGGTTCGG + Intergenic
1187206523 X:17186911-17186933 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
1187551766 X:20313123-20313145 TTGGAAACTCAGAAGAGGGGAGG - Intergenic
1187586657 X:20669993-20670015 TTGGATACTCAGAAGGGGGAAGG - Intergenic
1187653918 X:21447719-21447741 CTGGAGACACAGAAGAGCATGGG - Intronic
1187716601 X:22108342-22108364 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188181439 X:27060815-27060837 ATGGAGGCTCAGAAGGGTGGAGG - Intergenic
1188220903 X:27540554-27540576 CTAGAGGCTAAGAAGGGTGTGGG + Intergenic
1188959988 X:36479377-36479399 CTGGAAACTCATGAGGGGCTAGG + Intergenic
1188964293 X:36531897-36531919 TTGGAGACTCAGAAAGCGTTGGG - Intergenic
1189166871 X:38869032-38869054 CTGGTGACTCACAAGTGGCTAGG + Intergenic
1189167478 X:38874955-38874977 TTGAAGACTCAGAATGGGGGAGG - Intergenic
1189237580 X:39499558-39499580 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1189507582 X:41627561-41627583 CTAGAGACTCAGAATAGGGGAGG - Intronic
1189607026 X:42689720-42689742 TTGGAGGCTCAGAAGTGGGGAGG - Intergenic
1190056340 X:47183215-47183237 ATGGAGACTCAAAAGGTGGAGGG + Intronic
1190463079 X:50698343-50698365 CTGGTGACTGAGAAGGGGCATGG - Intronic
1191008159 X:55733124-55733146 CTGGAGACACAGAAACGGGGAGG - Intronic
1191673177 X:63768135-63768157 TTGGAGACTCAGAAGGGGAAGGG - Intronic
1192058408 X:67797531-67797553 TTGGAGACTAAGAAGGGGGAGGG + Intergenic
1192284389 X:69719505-69719527 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1192884445 X:75321994-75322016 TTGGAGACTGAGAAGGGGTAGGG - Intergenic
1192961375 X:76134863-76134885 CTGGAGACTCAGAAGCAGAGAGG + Intergenic
1193187515 X:78530448-78530470 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1193222977 X:78948620-78948642 CTAGAGACTCAGAAGAGGGTGGG - Intronic
1193460316 X:81783798-81783820 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1194047497 X:89026546-89026568 TTGGAGACTCAGAAGAGAGGAGG - Intergenic
1194088515 X:89558244-89558266 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1194089909 X:89572931-89572953 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1194145648 X:90258690-90258712 TTGGAGATTCAGGAGGGGGAAGG + Intergenic
1194228439 X:91291606-91291628 TTGGAGACTCAGAAGTGGGTAGG - Intergenic
1194453931 X:94079529-94079551 TTGGAGACTCAGAAGCAGGGAGG - Intergenic
1194615312 X:96093651-96093673 TTGGAGACTCAGAAGGGAGGAGG + Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1196126009 X:112099572-112099594 CTGGAGCCTAGGAAGTGGGTGGG + Intergenic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1196796847 X:119508749-119508771 CTAGAGACTCAGAAAGGGGAGGG - Intergenic
1197339405 X:125247355-125247377 CTGGAGACTTGAAAGGGGGGTGG + Intergenic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1197987602 X:132283612-132283634 TTGGCGTCTCAGAAGGGGGAAGG - Intergenic
1198038327 X:132823431-132823453 TTAGAGACTCAGAAGGAGGAGGG - Intronic
1198040621 X:132848018-132848040 CTGGTGCATCAGATGGGGGTGGG + Intronic
1198105031 X:133453961-133453983 TTGGAGATGCAGAAGAGGGTAGG - Intergenic
1198134421 X:133733273-133733295 TTAGGGACTCAGAAGGGGGAGGG + Intronic
1198319684 X:135507590-135507612 TTGGCGACTCAGAAGTGGGGAGG - Intergenic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198661753 X:138976533-138976555 ATAAAGACTCAGAAGGGGGATGG + Intronic
1198676451 X:139136354-139136376 TTAGAGACTCAGAACGGGGAGGG - Intronic
1198845904 X:140910187-140910209 CTGGAGATTCAGATGAGAGTTGG - Intergenic
1199078096 X:143546956-143546978 TTAGAGACTCAGAAGGGGGAAGG + Intergenic
1199110821 X:143931843-143931865 TTGGAGATTCAGAAGGGGAAGGG - Intergenic
1199242274 X:145561180-145561202 TTGGAGACTTAGAAGGGGAAGGG + Intergenic
1199326733 X:146507430-146507452 TTGGAGAATCAGAAGGGGAGAGG + Intergenic
1200102866 X:153696721-153696743 CTGGGGACTGGGAAGGGGGCAGG + Intergenic
1200267872 X:154655501-154655523 CTGGGGACTGGGAAGGGGGCAGG + Intergenic
1200353995 X:155528489-155528511 CTGGAGACTCAGAAGGGGAGAGG - Intronic
1200377259 X:155796259-155796281 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1200441191 Y:3214291-3214313 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1200442560 Y:3228985-3229007 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200794309 Y:7326496-7326518 CTGGAGACTCAGAAGTGGGGAGG + Intergenic
1201066423 Y:10099957-10099979 ATGGAGACTCAGGAGGGTGAGGG - Intergenic
1201145241 Y:11061156-11061178 CAGGAGACTCAGAAGTGTGATGG + Intergenic
1201277380 Y:12312198-12312220 CTGGTGGCCCAGATGGGGGTTGG + Intergenic
1201474833 Y:14369228-14369250 CTGGAGACTCAGAATCTGGGAGG + Intergenic
1201761461 Y:17543930-17543952 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1201840091 Y:18362060-18362082 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1201944333 Y:19495876-19495898 GTGGAGGCTGAGATGGGGGTGGG - Intergenic