ID: 1058590261

View in Genome Browser
Species Human (GRCh38)
Location 9:106557931-106557953
Sequence AAGCCACCTCACATCAGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058590253_1058590261 10 Left 1058590253 9:106557898-106557920 CCTCCTTGTTCACCACAGTGCTG No data
Right 1058590261 9:106557931-106557953 AAGCCACCTCACATCAGCCAGGG No data
1058590256_1058590261 -2 Left 1058590256 9:106557910-106557932 CCACAGTGCTGTTGCCCCTGGAA No data
Right 1058590261 9:106557931-106557953 AAGCCACCTCACATCAGCCAGGG No data
1058590252_1058590261 18 Left 1058590252 9:106557890-106557912 CCTGGCTTCCTCCTTGTTCACCA No data
Right 1058590261 9:106557931-106557953 AAGCCACCTCACATCAGCCAGGG No data
1058590254_1058590261 7 Left 1058590254 9:106557901-106557923 CCTTGTTCACCACAGTGCTGTTG No data
Right 1058590261 9:106557931-106557953 AAGCCACCTCACATCAGCCAGGG No data
1058590251_1058590261 30 Left 1058590251 9:106557878-106557900 CCTCACTGTTGTCCTGGCTTCCT No data
Right 1058590261 9:106557931-106557953 AAGCCACCTCACATCAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058590261 Original CRISPR AAGCCACCTCACATCAGCCA GGG Intergenic
No off target data available for this crispr