ID: 1058593457

View in Genome Browser
Species Human (GRCh38)
Location 9:106589503-106589525
Sequence AAGAAGAAGAAGAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058593453_1058593457 9 Left 1058593453 9:106589471-106589493 CCATGCACAAAGCTTGATATAAA No data
Right 1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG No data
1058593452_1058593457 12 Left 1058593452 9:106589468-106589490 CCTCCATGCACAAAGCTTGATAT No data
Right 1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058593457 Original CRISPR AAGAAGAAGAAGAATGAGGA GGG Intergenic
No off target data available for this crispr