ID: 1058596525

View in Genome Browser
Species Human (GRCh38)
Location 9:106621455-106621477
Sequence TGCATTGTGCACTCACATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058596525_1058596527 15 Left 1058596525 9:106621455-106621477 CCTTTATGTGAGTGCACAATGCA No data
Right 1058596527 9:106621493-106621515 TGACTCTTGAGAAATACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058596525 Original CRISPR TGCATTGTGCACTCACATAA AGG (reversed) Intergenic
No off target data available for this crispr