ID: 1058599718

View in Genome Browser
Species Human (GRCh38)
Location 9:106656216-106656238
Sequence GTGGTCTGGCAGGAAAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058599718_1058599721 -7 Left 1058599718 9:106656216-106656238 CCAGTGTTTTCCTGCCAGACCAC No data
Right 1058599721 9:106656232-106656254 AGACCACACTGCCACATGAAAGG No data
1058599718_1058599722 -6 Left 1058599718 9:106656216-106656238 CCAGTGTTTTCCTGCCAGACCAC No data
Right 1058599722 9:106656233-106656255 GACCACACTGCCACATGAAAGGG No data
1058599718_1058599726 23 Left 1058599718 9:106656216-106656238 CCAGTGTTTTCCTGCCAGACCAC No data
Right 1058599726 9:106656262-106656284 AACTTATGTTAATGTCCAAAAGG No data
1058599718_1058599728 28 Left 1058599718 9:106656216-106656238 CCAGTGTTTTCCTGCCAGACCAC No data
Right 1058599728 9:106656267-106656289 ATGTTAATGTCCAAAAGGCTGGG No data
1058599718_1058599723 -5 Left 1058599718 9:106656216-106656238 CCAGTGTTTTCCTGCCAGACCAC No data
Right 1058599723 9:106656234-106656256 ACCACACTGCCACATGAAAGGGG No data
1058599718_1058599727 27 Left 1058599718 9:106656216-106656238 CCAGTGTTTTCCTGCCAGACCAC No data
Right 1058599727 9:106656266-106656288 TATGTTAATGTCCAAAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058599718 Original CRISPR GTGGTCTGGCAGGAAAACAC TGG (reversed) Intergenic
No off target data available for this crispr