ID: 1058608825

View in Genome Browser
Species Human (GRCh38)
Location 9:106753001-106753023
Sequence GGGTCTTATGGCCCCCCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058608825_1058608833 25 Left 1058608825 9:106753001-106753023 CCAGATGGGGGGCCATAAGACCC No data
Right 1058608833 9:106753049-106753071 GCCCTCTCCCATAGGCATTCAGG No data
1058608825_1058608832 17 Left 1058608825 9:106753001-106753023 CCAGATGGGGGGCCATAAGACCC No data
Right 1058608832 9:106753041-106753063 AAGAAAGAGCCCTCTCCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058608825 Original CRISPR GGGTCTTATGGCCCCCCATC TGG (reversed) Intergenic
No off target data available for this crispr