ID: 1058610558

View in Genome Browser
Species Human (GRCh38)
Location 9:106771223-106771245
Sequence CCATCTTGGAAGTAGAGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058610552_1058610558 5 Left 1058610552 9:106771195-106771217 CCCTCCAGAGGATGCAGCATTCA 0: 8
1: 19
2: 62
3: 143
4: 392
Right 1058610558 9:106771223-106771245 CCATCTTGGAAGTAGAGACCAGG No data
1058610555_1058610558 1 Left 1058610555 9:106771199-106771221 CCAGAGGATGCAGCATTCAAGGT No data
Right 1058610558 9:106771223-106771245 CCATCTTGGAAGTAGAGACCAGG No data
1058610553_1058610558 4 Left 1058610553 9:106771196-106771218 CCTCCAGAGGATGCAGCATTCAA 0: 7
1: 19
2: 45
3: 110
4: 299
Right 1058610558 9:106771223-106771245 CCATCTTGGAAGTAGAGACCAGG No data
1058610551_1058610558 6 Left 1058610551 9:106771194-106771216 CCCCTCCAGAGGATGCAGCATTC No data
Right 1058610558 9:106771223-106771245 CCATCTTGGAAGTAGAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058610558 Original CRISPR CCATCTTGGAAGTAGAGACC AGG Intergenic
No off target data available for this crispr