ID: 1058618869

View in Genome Browser
Species Human (GRCh38)
Location 9:106862981-106863003
Sequence CTCTGAATAATGAGCAACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 118}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058618869_1058618874 -5 Left 1058618869 9:106862981-106863003 CCCTGGTTGCTCATTATTCAGAG 0: 1
1: 0
2: 1
3: 16
4: 118
Right 1058618874 9:106862999-106863021 CAGAGAGAGACACAGAGGGAGGG 0: 1
1: 6
2: 113
3: 1205
4: 6996
1058618869_1058618871 -10 Left 1058618869 9:106862981-106863003 CCCTGGTTGCTCATTATTCAGAG 0: 1
1: 0
2: 1
3: 16
4: 118
Right 1058618871 9:106862994-106863016 TTATTCAGAGAGAGACACAGAGG 0: 1
1: 0
2: 1
3: 48
4: 484
1058618869_1058618876 17 Left 1058618869 9:106862981-106863003 CCCTGGTTGCTCATTATTCAGAG 0: 1
1: 0
2: 1
3: 16
4: 118
Right 1058618876 9:106863021-106863043 GAGAGAGAGAGAGCGCGCGAGGG 0: 2
1: 2
2: 56
3: 2613
4: 7813
1058618869_1058618877 22 Left 1058618869 9:106862981-106863003 CCCTGGTTGCTCATTATTCAGAG 0: 1
1: 0
2: 1
3: 16
4: 118
Right 1058618877 9:106863026-106863048 AGAGAGAGCGCGCGAGGGAGAGG 0: 1
1: 1
2: 14
3: 348
4: 5843
1058618869_1058618873 -6 Left 1058618869 9:106862981-106863003 CCCTGGTTGCTCATTATTCAGAG 0: 1
1: 0
2: 1
3: 16
4: 118
Right 1058618873 9:106862998-106863020 TCAGAGAGAGACACAGAGGGAGG 0: 1
1: 2
2: 12
3: 256
4: 2425
1058618869_1058618875 16 Left 1058618869 9:106862981-106863003 CCCTGGTTGCTCATTATTCAGAG 0: 1
1: 0
2: 1
3: 16
4: 118
Right 1058618875 9:106863020-106863042 GGAGAGAGAGAGAGCGCGCGAGG 0: 2
1: 1
2: 38
3: 429
4: 5289
1058618869_1058618879 26 Left 1058618869 9:106862981-106863003 CCCTGGTTGCTCATTATTCAGAG 0: 1
1: 0
2: 1
3: 16
4: 118
Right 1058618879 9:106863030-106863052 AGAGCGCGCGAGGGAGAGGGAGG 0: 1
1: 1
2: 3
3: 101
4: 1450
1058618869_1058618872 -9 Left 1058618869 9:106862981-106863003 CCCTGGTTGCTCATTATTCAGAG 0: 1
1: 0
2: 1
3: 16
4: 118
Right 1058618872 9:106862995-106863017 TATTCAGAGAGAGACACAGAGGG 0: 1
1: 0
2: 4
3: 98
4: 775
1058618869_1058618878 23 Left 1058618869 9:106862981-106863003 CCCTGGTTGCTCATTATTCAGAG 0: 1
1: 0
2: 1
3: 16
4: 118
Right 1058618878 9:106863027-106863049 GAGAGAGCGCGCGAGGGAGAGGG 0: 1
1: 1
2: 8
3: 403
4: 5440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058618869 Original CRISPR CTCTGAATAATGAGCAACCA GGG (reversed) Intergenic
912642309 1:111359395-111359417 CTCAGAACAATGAGAAGCCAGGG + Intergenic
912779607 1:112533118-112533140 CTCTGAATCATTACAAACCAGGG + Intronic
915531758 1:156506405-156506427 TTCTGAATATTGACCATCCAAGG + Intergenic
916214340 1:162382964-162382986 CTCTGAACACTGAGTAAGCATGG + Intronic
919554596 1:199034974-199034996 CTCTGCAAAATGAGAGACCAGGG + Intergenic
920393718 1:205628648-205628670 GTCTCCATAATGAGCACCCAAGG + Intronic
920935654 1:210432071-210432093 CCCTGAAAAGTGAGCATCCATGG + Intronic
921235779 1:213127455-213127477 CTCTGCATACTGAACTACCATGG + Intronic
921395050 1:214659908-214659930 CTCTGACAAGTGAGCAATCAAGG - Intronic
922962813 1:229662823-229662845 CTATGAGTTATGAGAAACCAGGG - Intergenic
923414201 1:233739005-233739027 TTCTGAATAATGCCCACCCACGG + Intergenic
924557213 1:245128621-245128643 CTCTGAAGGATGGGCACCCAGGG - Intergenic
1063187773 10:3666105-3666127 GGCTGAATAATCAGCATCCAGGG - Intergenic
1066048130 10:31612123-31612145 TTCTGAACAATCAGCAACCTGGG - Intergenic
1067859049 10:49825725-49825747 CTTTTAAGAATGAGAAACCAAGG - Intronic
1068668582 10:59701423-59701445 CTGTGGGTAATGAGGAACCATGG - Intronic
1076463653 10:130663742-130663764 TTCTCAATACTGAGCAATCAGGG - Intergenic
1076995302 11:294740-294762 CTCTGAATAATCAGGAACGGTGG + Exonic
1083337367 11:61931501-61931523 CTCTTAATAATGAGCAATCAAGG + Intergenic
1085463714 11:76710344-76710366 CTGTGAATAATGAGCATTCCAGG - Intergenic
1091301693 11:134512068-134512090 CTCTGAATTAAGAGCAAGGAAGG + Intergenic
1091450292 12:568675-568697 ATCTCAATAATGAACAACCCAGG - Intronic
1091672542 12:2462591-2462613 ATCTGTAGAATGAGCAAACATGG + Intronic
1092313736 12:7387693-7387715 GTCTGAATACTGAACAAGCATGG - Intronic
1093781576 12:23143196-23143218 CTCTGAACAATGAGAACACATGG - Intergenic
1094806236 12:34095644-34095666 CTTTTTAAAATGAGCAACCAGGG - Intergenic
1095124924 12:38465478-38465500 CTTTTTAAAATGAGCAACCAGGG - Intergenic
1095453959 12:42362840-42362862 CCCTGAATAATGAGTGACCAGGG - Intronic
1095621342 12:44258312-44258334 CTATGTATAATGAGCAGCCGTGG + Intronic
1097469774 12:59974584-59974606 CTCTCAATAATAAGCAATCTGGG - Intergenic
1100738193 12:97561674-97561696 CTCTGAATGAGCAGCCACCAAGG - Intergenic
1106871003 13:34020711-34020733 CACTGAATAATCACCAAACAAGG - Intergenic
1106910595 13:34459160-34459182 CTCTAATCAATGATCAACCATGG + Intergenic
1110286815 13:73759389-73759411 CTATAAATAATGAGCATGCAAGG + Intronic
1111714553 13:91863649-91863671 CTCTGGATAATGAGGATGCATGG - Intronic
1120354086 14:83406833-83406855 GACTCAATAATTAGCAACCACGG + Intergenic
1125633306 15:41166370-41166392 CTCTGTATAATAACCAACCATGG + Intergenic
1130215536 15:81965369-81965391 CCCTGAGTAATGAGAAACCAGGG + Intergenic
1131184714 15:90264871-90264893 CTCTGAACACAGAGCAGCCAAGG + Exonic
1133167581 16:3958973-3958995 CTCTGAATAAAAAGCAACCGAGG - Intronic
1135621616 16:23960679-23960701 CGCTGAATAATGAGAACACATGG - Intronic
1138381575 16:56606565-56606587 ATCTGAGTTATTAGCAACCAGGG + Intergenic
1140892386 16:79296309-79296331 CTCTGAACAATGAGAATACATGG + Intergenic
1143076228 17:4346294-4346316 GTCTGGATAAGGAGCAACAAAGG - Intronic
1143341044 17:6211148-6211170 ATCTGAATAATGAACTACCATGG + Intergenic
1144174419 17:12691288-12691310 CTGTGAAGAATGAGCGAGCATGG + Intronic
1148078415 17:44953472-44953494 CTTTAAAGAATGAGCAAGCATGG + Intergenic
1150109897 17:62489718-62489740 ATGTGAATAATGAGAAACTAGGG - Intronic
1153122159 18:1741701-1741723 CTTTTAATAATTATCAACCAAGG - Intergenic
1155579925 18:27292330-27292352 CTATGAATAATAAGAAGCCATGG - Intergenic
1157477525 18:48032981-48033003 CTCTGAATAATGAATTCCCAGGG - Intronic
1159345683 18:67200501-67200523 CTCTTAATAATGATAAACAATGG - Intergenic
1162873077 19:13600389-13600411 TTCTGCAAAATGAGCCACCATGG + Intronic
1164191189 19:22918687-22918709 CTCTGAATAGGGAGTAAGCAGGG - Intergenic
1166008909 19:39926871-39926893 TTCTAAATATTTAGCAACCAGGG - Intronic
1167224347 19:48227438-48227460 CTCTGAATATTGAGTTTCCAGGG - Intronic
925607104 2:5670777-5670799 TACTGAATAAAGAGCACCCAGGG + Intergenic
926422254 2:12711580-12711602 CACTGAGTAATGGGCTACCATGG + Intergenic
926712207 2:15890718-15890740 CTCTGAATAAAGACCAAGGAAGG + Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
930739171 2:54811708-54811730 CTCAGCTTAATGAGCAAACATGG + Intronic
939490279 2:142868486-142868508 CTCAGAAAAACAAGCAACCACGG + Intergenic
940127606 2:150344366-150344388 CTCTGAATCATCTGCAAGCAGGG + Intergenic
940448752 2:153811685-153811707 CTCTAAATAAGGAGCCACAAGGG - Intergenic
943995023 2:194751740-194751762 CTCTAAATGATGAGAAAACATGG + Intergenic
945342161 2:208669136-208669158 CTCTAAATAAAGAACAACCATGG - Intronic
946046860 2:216828586-216828608 GTCTGAATAATGCGCACCAAAGG + Intergenic
946217011 2:218192250-218192272 GTTTGTATTATGAGCAACCAGGG + Intergenic
947072268 2:226302759-226302781 CTATGAATAATGAGAGACCCTGG + Intergenic
1176154588 20:63612192-63612214 CTCAGAATAAAGACCAACCTGGG + Intronic
1177106422 21:16961602-16961624 CTTAGAAAAATGAGCAACAAAGG - Intergenic
1178673721 21:34614247-34614269 CGCTGGCTAATGAGCAACCACGG + Intronic
1182929761 22:34161607-34161629 CTCCAATTAAAGAGCAACCAAGG + Intergenic
950273338 3:11637777-11637799 CTTTTAAAAATAAGCAACCACGG + Intronic
952661400 3:35853649-35853671 AGCTGAATAATGAGAACCCATGG - Intergenic
954187439 3:48928897-48928919 CTCTGAAGAATGAGGACCTATGG + Intronic
955466125 3:59238842-59238864 CACTGGCTAATGAGCAACCCAGG + Intergenic
958440369 3:94149003-94149025 CTATGAATAATGCTCAGCCAAGG - Intergenic
963250644 3:143100046-143100068 CTTTGAATCAGGAGGAACCATGG + Intergenic
967777360 3:193398296-193398318 GTCTGAATAAAGATCAAGCAGGG + Intergenic
971896446 4:32603077-32603099 TTCTGAAGGATGAGCACCCAAGG + Intergenic
972852351 4:43066617-43066639 CTCTGAATCATGAATAAACAGGG + Intergenic
972929898 4:44059423-44059445 CTATGAATGATGAGGAAACAAGG - Intergenic
975590679 4:75996622-75996644 CTCTGAATAATGGGGAAACAGGG - Intergenic
976685115 4:87805100-87805122 ATCTGAAGAATGAGCCAGCAGGG + Intronic
979209972 4:118088462-118088484 CTCAAAATAATGAGTAGCCAAGG + Intronic
982459339 4:155649194-155649216 TCCTCAATAAAGAGCAACCAAGG + Intergenic
982613071 4:157602213-157602235 TTCTGAATGATGAGTAATCAAGG - Intergenic
983608916 4:169620656-169620678 CCCGGAATAATGAGCAAGGAGGG + Exonic
991277377 5:64865222-64865244 CCCTGAATATTTAACAACCAAGG - Intronic
992595893 5:78347156-78347178 CTTTGAAACATGAGGAACCAGGG - Intergenic
995736173 5:115302182-115302204 CTGTGGAAAATGAGCAAGCAGGG - Intergenic
998105022 5:139462907-139462929 CTATGCACAATGACCAACCATGG + Intergenic
1001023144 5:168200655-168200677 CCCTGAATAATCAGAAAACAGGG + Intronic
1007487679 6:42193538-42193560 CTCTGAATCAGCAGCAACCCTGG - Intronic
1008397716 6:51028013-51028035 CTCTAAATAATGAGAACACATGG - Intergenic
1011364645 6:86568558-86568580 CTCTGCACTTTGAGCAACCAGGG - Intergenic
1014098035 6:117481766-117481788 CTCGGAGTAGTGAGCAGCCACGG - Intronic
1015999858 6:139031013-139031035 CATTGAATAATGAGCATCAAAGG - Intronic
1016987656 6:149907207-149907229 CTCTCAATAATGATCAACCTTGG + Intergenic
1018585686 6:165355504-165355526 CTCTGAATCATGAGACAACATGG - Intronic
1020606109 7:10338836-10338858 TTCTGAATAATGAACAATCGAGG - Intergenic
1021441267 7:20679773-20679795 GTCAGAATATAGAGCAACCATGG + Intronic
1027983956 7:85261477-85261499 CTATTAATACTGAGGAACCATGG + Intergenic
1028857779 7:95611489-95611511 AAATCAATAATGAGCAACCAAGG - Intergenic
1028911972 7:96217944-96217966 CTCTTACTAATGAGTAACCCTGG + Intronic
1031269036 7:119621375-119621397 CTCTGAATTAGCAGGAACCATGG - Intergenic
1032422391 7:131793048-131793070 CTCTGCATACTGAACAACCATGG - Intergenic
1032666272 7:134039651-134039673 CCCAGTACAATGAGCAACCATGG + Intronic
1032710666 7:134458115-134458137 ATCTGAAAATTGAGCAACAAAGG - Intronic
1039535794 8:38311215-38311237 CTCTATATAATGAGTAATCAGGG - Intronic
1041994144 8:64032455-64032477 TTCTGAATAAATAGCCACCATGG + Intergenic
1043373095 8:79615285-79615307 CTGTGAGCAATGAGCTACCAAGG - Intronic
1045848848 8:106669505-106669527 CTCTCAATAATGAGATACTAGGG - Intronic
1046669089 8:117037696-117037718 CTTAGAATAATGAGAAAACAAGG + Intronic
1050422443 9:5480436-5480458 CTCTGAAAAGTTAGAAACCAAGG - Intergenic
1052156966 9:25204020-25204042 CTGAGAAAAATGTGCAACCATGG + Intergenic
1052549279 9:29927412-29927434 CTCAGAATAAAGATAAACCATGG - Intergenic
1053532467 9:38896270-38896292 CTCTGAATAATGAGCAAAGGTGG - Intergenic
1054204692 9:62120691-62120713 CTCTGAATAATGAGCAAAGGTGG - Intergenic
1054633667 9:67467667-67467689 CTCTGAATAATGAGCAAAGGTGG + Intergenic
1057151461 9:92799603-92799625 CTCTGAATGATGAGCAAAGGTGG + Intergenic
1058618869 9:106862981-106863003 CTCTGAATAATGAGCAACCAGGG - Intergenic
1058858224 9:109087764-109087786 CACTAAATAACGAGCAACTAAGG - Intronic
1187012414 X:15293603-15293625 CTCTGAATCATGAACAAACATGG + Intronic
1187666109 X:21611532-21611554 ACCTGAAGAATGAGCAAGCATGG - Intronic
1188340630 X:28996818-28996840 CTCAGAATTATCAGCAATCAGGG - Intronic
1188866989 X:35325559-35325581 CTCTGGAGAATGAGAAGCCATGG - Intergenic
1189112141 X:38302397-38302419 CTCTGAATCAAGAGCAAACGTGG + Intronic
1193052920 X:77120277-77120299 CTCTTAATAATAAACACCCAAGG + Intergenic
1193433832 X:81447098-81447120 CTCAGAAAAATGAGAAACAAAGG - Intergenic
1193653856 X:84173384-84173406 ATCTGTAAAATGAGCAACCTAGG + Intronic
1196017986 X:110959736-110959758 CTCTGTAGAATGTGCAACCCAGG - Intronic
1198012488 X:132572474-132572496 CTGTGAATCAGGAGCAACCAAGG + Intergenic
1198944796 X:141998770-141998792 CTCTGAATTAAGATAAACCAAGG - Intergenic
1200835758 Y:7729662-7729684 CACTGGAGAATGAGAAACCAGGG - Intergenic