ID: 1058624548

View in Genome Browser
Species Human (GRCh38)
Location 9:106921188-106921210
Sequence CCTGTTCTACATCAGGATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 187}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058624548_1058624559 19 Left 1058624548 9:106921188-106921210 CCTAAATCCTGATGTAGAACAGG 0: 1
1: 0
2: 0
3: 15
4: 187
Right 1058624559 9:106921230-106921252 TGCTCTGACCAGGGCTCTGCTGG No data
1058624548_1058624557 10 Left 1058624548 9:106921188-106921210 CCTAAATCCTGATGTAGAACAGG 0: 1
1: 0
2: 0
3: 15
4: 187
Right 1058624557 9:106921221-106921243 GGGTCATCCTGCTCTGACCAGGG No data
1058624548_1058624553 -10 Left 1058624548 9:106921188-106921210 CCTAAATCCTGATGTAGAACAGG 0: 1
1: 0
2: 0
3: 15
4: 187
Right 1058624553 9:106921201-106921223 GTAGAACAGGATCTGGCCCAGGG No data
1058624548_1058624556 9 Left 1058624548 9:106921188-106921210 CCTAAATCCTGATGTAGAACAGG 0: 1
1: 0
2: 0
3: 15
4: 187
Right 1058624556 9:106921220-106921242 AGGGTCATCCTGCTCTGACCAGG No data
1058624548_1058624560 20 Left 1058624548 9:106921188-106921210 CCTAAATCCTGATGTAGAACAGG 0: 1
1: 0
2: 0
3: 15
4: 187
Right 1058624560 9:106921231-106921253 GCTCTGACCAGGGCTCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058624548 Original CRISPR CCTGTTCTACATCAGGATTT AGG (reversed) Intronic
901624250 1:10614731-10614753 CTTGTTCTGCCTGAGGATTTTGG + Intronic
903364042 1:22794965-22794987 CCTCTGGTACAACAGGATTTGGG + Intronic
908291791 1:62674912-62674934 TCTTTTATGCATCAGGATTTTGG - Intronic
909372367 1:74898783-74898805 TCTTTTATGCATCAGGATTTTGG - Intergenic
913202215 1:116504125-116504147 CCTGTTCTTCATCAGCCTTTGGG - Intergenic
913229406 1:116729408-116729430 CCTGTTCTACAACAGGCACTGGG - Intergenic
913545547 1:119865538-119865560 ACTGTTCTAAAACTGGATTTTGG - Intergenic
916181252 1:162085639-162085661 CCATTTCTACATCTGCATTTAGG - Intronic
916322946 1:163525300-163525322 CCTCTTCTCCATCACCATTTCGG + Intergenic
916339485 1:163713356-163713378 CCTATTCTATATTAGGATTGTGG - Intergenic
918682470 1:187372508-187372530 CCTGTCCTGCATCATAATTTTGG - Intergenic
919485062 1:198135506-198135528 CCTGTTCTGCAACATGCTTTTGG - Intergenic
919970135 1:202570959-202570981 CATGCTCTAGATCAGCATTTAGG - Intronic
920154286 1:203935749-203935771 CCTGTTCTACAGAAAGATGTAGG - Intergenic
920169652 1:204063587-204063609 CATGTTCTTCAGCAGGATTTTGG + Intergenic
921989688 1:221350990-221351012 CCTGTTCTACATCTTAATTGTGG - Intergenic
923704402 1:236332318-236332340 CGTGTTGTCCATCAGAATTTAGG - Intergenic
1064101930 10:12471504-12471526 CCTGTTCCTCCTCAGGTTTTAGG - Intronic
1064848684 10:19685753-19685775 CCTGTTTTACATCAGAGTTGGGG + Intronic
1064966964 10:21024319-21024341 TCTCTCCTACATCAAGATTTTGG - Intronic
1067703373 10:48589366-48589388 CCTGGGCAACAGCAGGATTTGGG - Intronic
1067814474 10:49462636-49462658 CATTTTCTAAATCAGGTTTTTGG - Intronic
1070336031 10:75455870-75455892 CCTGTACAACATCAGGGCTTTGG + Intronic
1071455216 10:85843400-85843422 CCTTTTATATATCATGATTTTGG - Intronic
1072161190 10:92768411-92768433 CCTGATCAACATCTGCATTTTGG + Intergenic
1072434953 10:95406356-95406378 CCAGATCTACACCAGGATTCAGG + Intronic
1073440647 10:103550580-103550602 CCTGTTCTCCACCTGCATTTAGG + Intronic
1074411855 10:113235479-113235501 CCTGCTGGACATCAGGATTTGGG + Intergenic
1075440921 10:122478751-122478773 TCTGTGCTAAATCTGGATTTGGG + Intronic
1078754500 11:14196220-14196242 CCTGTTCTATATCAGGCCTAAGG - Intronic
1079573898 11:21979219-21979241 TCTGATTTACATCAGGATTCAGG + Intergenic
1079608393 11:22398972-22398994 CCTGTTATTCATTAGGTTTTAGG + Intergenic
1083257196 11:61503988-61504010 CCTGTCCTTCATGAGGACTTTGG - Intergenic
1083333637 11:61910802-61910824 CCTGTCCTACCTGAGGACTTGGG - Intronic
1085036993 11:73306773-73306795 CTCCTTCTTCATCAGGATTTGGG + Intergenic
1086531319 11:87788870-87788892 CCTGTTTTTCTTCAGCATTTTGG - Intergenic
1086667869 11:89506548-89506570 CCTTTTATAGATCATGATTTTGG - Intergenic
1086897648 11:92332253-92332275 CCTCTGCTCCATCTGGATTTCGG + Intergenic
1095755699 12:45764457-45764479 ACTGTTCTACATCTTCATTTTGG - Intronic
1099046730 12:77729743-77729765 CCTGCCTTATATCAGGATTTAGG - Intergenic
1100741711 12:97601015-97601037 CCTGTTAGACATCAGGATAGTGG - Intergenic
1101079914 12:101172081-101172103 CGTGTTCAAGATCACGATTTTGG - Intronic
1101479325 12:105082294-105082316 ACTGTTCTACATCTTGATTATGG - Intronic
1102740061 12:115199154-115199176 ACTTTTCTACATCAGTATGTTGG + Intergenic
1106452634 13:29896620-29896642 AATGTTCTATATCATGATTTGGG - Intergenic
1106780024 13:33049908-33049930 CCTGTTTTACAGCAGGATTGTGG - Intronic
1107021953 13:35761026-35761048 CCTGATTTACAGCAGGACTTTGG + Intergenic
1108258381 13:48632272-48632294 TCTTTTCTGCATCAGGATTCAGG + Intergenic
1113308862 13:109109668-109109690 CCTGATCTACATTAATATTTTGG - Intronic
1114060343 14:19011748-19011770 CCTCTGCTCCATCAGGAATTAGG - Intergenic
1114102010 14:19388858-19388880 CCTCTGCTCCATCAGGAATTAGG + Intergenic
1115119676 14:29925927-29925949 CCTTTTCCACATCAGTATTGTGG - Intronic
1118574096 14:67224133-67224155 CCTTTTCTGCATAAGGTTTTGGG + Intronic
1119030451 14:71188206-71188228 CTTGTTCAACAACAGGATCTTGG - Intergenic
1119296387 14:73536930-73536952 CCTCTTCGCCATCAGGAGTTTGG + Intronic
1119300641 14:73568957-73568979 CCTCTTCGCCATCAGGAGTTTGG + Intronic
1119321217 14:73731940-73731962 CTTGTACTACACCAGGCTTTGGG - Intronic
1127305205 15:57698673-57698695 ACTGTTCTATATCATGATTATGG + Intronic
1130131099 15:81143354-81143376 CCTGTTCCCCTTCAGGATATAGG - Intronic
1133657136 16:7876595-7876617 CCTGTTCTGTATCTTGATTTTGG - Intergenic
1134463368 16:14449435-14449457 CTTTTTCTACACCTGGATTTTGG - Intronic
1134806344 16:17129146-17129168 CCTGTTTTAAATCTGGACTTTGG + Intronic
1140600433 16:76469364-76469386 CCTCTCCTAAATCAGGTTTTAGG - Intronic
1141092345 16:81138768-81138790 TCTGCTCTACACCTGGATTTAGG + Intergenic
1141207700 16:81946160-81946182 CTTGTTCTGCTTCAGGATTCAGG + Exonic
1143220871 17:5260743-5260765 CCAGTTCTACATCATAATTTTGG - Intergenic
1149508510 17:57216571-57216593 CCTGTCCCACATAAGGAGTTGGG + Intergenic
1154017264 18:10630062-10630084 TCTGTTATACATCTGGATTAAGG - Intergenic
1154187597 18:12199535-12199557 TCTGTTATACATCTGGATTAAGG + Intergenic
1155190601 18:23426301-23426323 CCTGTTGTCCATCATGTTTTTGG - Intronic
1156595040 18:38539024-38539046 CCTTTTCTACATCATGATGGGGG + Intergenic
1159850643 18:73523083-73523105 CCTGTTCTATATAAAGATGTTGG - Intergenic
1160613167 18:80104761-80104783 GCTGGTCTACATCAGGTTTCTGG + Intergenic
1165393525 19:35551517-35551539 CGTGTTCTTCATCAGCATTGAGG - Exonic
1165576712 19:36825868-36825890 CCTGATCCAGATCATGATTTTGG - Intronic
1165610583 19:37148553-37148575 CCTGTTCTTCATCTTGATTGTGG + Exonic
927010988 2:18904058-18904080 TCTGTTGTTCATCAGGAATTCGG + Intergenic
927424409 2:22965495-22965517 ACTGTTCTACATCTTGATTCTGG - Intergenic
927480208 2:23447696-23447718 CCTTTTCTATTTCAGAATTTTGG - Intronic
927658268 2:24970713-24970735 CCTGTAATACATCAGCACTTTGG - Intronic
928357356 2:30631049-30631071 CCTGGTTTAAATCAGGTTTTTGG - Intronic
929517093 2:42613464-42613486 CTTGTTCTACATCAGCATGTGGG - Intronic
930326593 2:49927698-49927720 CCCATTCTATATCAGGAATTAGG - Intronic
930686687 2:54315936-54315958 TATGTTCTATATCTGGATTTAGG + Intergenic
932850113 2:75176622-75176644 GCTGTTCCACAGCAGGACTTTGG + Intronic
933912070 2:86950063-86950085 CCTGGTGTGCATCAGCATTTTGG + Intronic
934010924 2:87819834-87819856 CCTGGTGTGCATCAGCATTTTGG - Intronic
935774492 2:106460545-106460567 CCTGGTGTGCATCAGCATTTTGG - Intronic
935905577 2:107835369-107835391 CCTGGTGTGCATCAGCATTTTGG + Intronic
935992056 2:108727901-108727923 CCTGGTGTGCATCAGCATTTTGG + Intronic
936127370 2:109800602-109800624 CCTGGTGTGCATCAGCATTTTGG + Intronic
936217327 2:110570883-110570905 CCTGGTGTGCATCAGCATTTTGG - Intronic
936426467 2:112425457-112425479 CCTGGTGTGCATCAGCATTTTGG - Intronic
938084237 2:128388020-128388042 CCTTTTCAACCTGAGGATTTGGG - Intergenic
938273669 2:129997223-129997245 TCTGTTCTATATAAGGTTTTGGG + Intergenic
939119049 2:138093908-138093930 CTTCTTCTACATCAGTGTTTGGG + Intergenic
940341452 2:152586074-152586096 CCTGGAATTCATCAGGATTTCGG + Intronic
940607962 2:155951937-155951959 CATATTCTATCTCAGGATTTAGG - Intergenic
941919392 2:170834172-170834194 CCTGCTATATCTCAGGATTTTGG + Intronic
943296842 2:186151077-186151099 CCTCTTCTATCTCAAGATTTTGG + Intergenic
944137145 2:196412204-196412226 CCTGGTCAACATCTTGATTTTGG - Intronic
946105108 2:217362303-217362325 CCTGTTCTACATCTACATCTTGG + Intronic
946444901 2:219729951-219729973 CCTGTTCTATACCTTGATTTCGG - Intergenic
947727702 2:232410163-232410185 CCTGATCCACCTCAGGATATGGG - Exonic
1169024769 20:2360356-2360378 AATGTTCTACATCTTGATTTGGG - Intergenic
1170903093 20:20485170-20485192 CCTGCTCTAGTTCATGATTTGGG + Intronic
1172488447 20:35314736-35314758 CATGTTCTTCTTCAGGATATAGG + Exonic
1175159627 20:56998380-56998402 CCAGTTCCACATCAGGATGAAGG - Intergenic
1180478822 22:15734360-15734382 CCTCTGCTCCATCAGGAATTAGG - Intergenic
1181681627 22:24499539-24499561 CCAGTTCTACATCTGGTGTTGGG - Intronic
949631070 3:5927329-5927351 TCTTGTCTCCATCAGGATTTTGG - Intergenic
950308812 3:11938128-11938150 ACTGTTCTACATCTTGATTGTGG - Intergenic
950857225 3:16116846-16116868 CCCTTTCTACATCTTGATTTTGG - Intergenic
951083361 3:18479210-18479232 CCTATTCTACACCAAGAGTTAGG + Intergenic
952091759 3:29895367-29895389 CCTGTTCTACATCTTGATTGTGG - Intronic
953094779 3:39764781-39764803 ACTGTTCTATATCATGAGTTTGG + Intergenic
953149617 3:40312933-40312955 CTTTTACTACATCATGATTTTGG + Intergenic
954076079 3:48181952-48181974 CCTGTTTTACTTCAATATTTTGG - Intronic
955532368 3:59887317-59887339 CCTGTTCTTCCCCAGGCTTTTGG - Intronic
956772743 3:72540263-72540285 GATGTTCTAAAGCAGGATTTGGG + Intergenic
957216388 3:77325318-77325340 GCTGTTCTGCTTCAGGGTTTTGG + Intronic
959368215 3:105490598-105490620 CATGTTATAGATTAGGATTTAGG + Intronic
960103518 3:113769784-113769806 CCTCTTCTACCACAGGGTTTTGG + Intronic
963446914 3:145423752-145423774 ACTGGTCTATCTCAGGATTTAGG + Intergenic
965561986 3:170070958-170070980 AATGTTCTACATCTGGATTGGGG - Intronic
966314480 3:178630394-178630416 GCTGTTCCACATAAGAATTTTGG + Intronic
967523213 3:190460272-190460294 GCTGTGCTACATCATCATTTTGG + Intergenic
971110867 4:23584479-23584501 CCTTTTCTCCAACAGAATTTAGG - Intergenic
977851016 4:101829306-101829328 TCTCTTCTACGTCAGGCTTTTGG + Intronic
978009625 4:103663649-103663671 CCCTTTCTACAACAGTATTTTGG - Intronic
979363348 4:119790946-119790968 ACTGTTCTACATCTTGCTTTTGG - Intergenic
980020375 4:127702545-127702567 ACTGTTCTACATCTCAATTTTGG + Intronic
980024093 4:127744324-127744346 GGTGTTATACATCAGGATTTGGG + Intronic
980143216 4:128947284-128947306 CCTGTTACACATCAGGGTTTGGG - Intronic
980809027 4:137851920-137851942 TCTGTTTTACTTCAGGATATTGG + Intergenic
981464149 4:145047849-145047871 ACTGTTCTACCTTAGTATTTAGG - Intronic
983120529 4:163878481-163878503 GCTTTTCTAACTCAGGATTTGGG + Intronic
986876326 5:12115451-12115473 CATCTTCAACATCAAGATTTTGG - Intergenic
988220283 5:28336615-28336637 ATTGTTCTACCTCATGATTTGGG - Intergenic
989074092 5:37544066-37544088 CCTGGTCTTAATCAGGTTTTTGG + Intronic
993517809 5:88859406-88859428 TCTGTGCTACATGAGGATTCTGG - Intronic
995616468 5:113969983-113970005 CCTGCTCAACATTAGGAATTTGG - Intergenic
998754324 5:145359375-145359397 CCTGTTCTCAATCAGGAATACGG + Intergenic
998830859 5:146157204-146157226 ACTGTTCTATATCTTGATTTAGG + Intronic
1000263186 5:159609825-159609847 CCTTTGCTCCAGCAGGATTTTGG + Intergenic
1002017221 5:176334539-176334561 GCTGTTCTCCACCAGGCTTTTGG + Intronic
1003865573 6:10359529-10359551 CCTCTGCTACATCAGGGTTGGGG - Intergenic
1005702769 6:28419186-28419208 CATGTTATACATCAGAACTTAGG + Intergenic
1006869848 6:37241606-37241628 CAGGTTCTACATCTGGATTCTGG + Intronic
1007164669 6:39820990-39821012 CATGTTCTACATCAGGAAAGTGG + Intronic
1007215638 6:40235250-40235272 CCTGTTCTTCATCACCAGTTGGG + Intergenic
1007529319 6:42526933-42526955 CCTGCTCTGCTTCAGGCTTTGGG - Intergenic
1008258542 6:49335188-49335210 CCTGTTCTACTTCTGGTTTCTGG - Intergenic
1008604245 6:53124483-53124505 CATGTTCTATATCTTGATTTTGG + Intergenic
1008622375 6:53283288-53283310 CCTTTTCCACATAAAGATTTTGG - Intronic
1013323048 6:109013927-109013949 CCTTTTCAACATCATGTTTTGGG + Intronic
1013903524 6:115186664-115186686 CTTGTTCTACATCCTGATTGTGG + Intergenic
1014625713 6:123721960-123721982 TCTGGTCTTCATGAGGATTTAGG + Intergenic
1015516910 6:134091769-134091791 TCTATTCTAAATCAGGGTTTGGG - Intergenic
1016525545 6:144998015-144998037 GCTGTTCTCCAGGAGGATTTAGG + Intergenic
1019125385 6:169837011-169837033 CCTCTTCTGCATCGTGATTTTGG - Intergenic
1022287640 7:28969460-28969482 CCTGATCTAAATCCTGATTTGGG - Intergenic
1023504047 7:40881575-40881597 CCTCTTTTATATCAGGATATGGG - Intergenic
1024538427 7:50457705-50457727 CCTGTTCTCCATCATGATGTGGG - Intronic
1024595077 7:50925965-50925987 ACTGTTCTAGATCTTGATTTGGG - Intergenic
1027191303 7:75997071-75997093 CCTGGTCTCCATCTGGATTGAGG + Intronic
1028214016 7:88109673-88109695 CATGTTCCACATCAGGAAATGGG - Intronic
1029912535 7:104169641-104169663 CCTGTTCTTCATGCAGATTTTGG - Intronic
1030272976 7:107689948-107689970 CTTGTACGACATCAGGAGTTTGG - Intronic
1033248382 7:139737614-139737636 CCTCTGCTACACCAGGAGTTTGG + Intronic
1035763776 8:2088905-2088927 CCTCTCCTACATCAGAATATGGG - Intronic
1039021709 8:33214727-33214749 CATGTTCTATATCATGATTATGG + Intergenic
1039239120 8:35535480-35535502 GCTGTTGTACCTCAAGATTTTGG - Intronic
1040583920 8:48722115-48722137 CCATTTCTAAATCAGGTTTTGGG - Intronic
1043074425 8:75678491-75678513 CCTTTTCTCCATAATGATTTAGG - Intergenic
1043756619 8:84011561-84011583 CCTGGTGTGCATCAGGATCTTGG + Intergenic
1044572760 8:93738288-93738310 ACTTTTCTACATCATCATTTGGG - Intronic
1045008110 8:97933535-97933557 CCTATTCGACACCAGGATTGCGG - Intronic
1046115546 8:109779411-109779433 CCTGTACTGCTTCTGGATTTGGG - Intergenic
1053263159 9:36689165-36689187 CAGGCTCTACATCAGGATTTGGG + Intergenic
1054843001 9:69762662-69762684 GCTGTTTTACATCAAAATTTGGG - Intergenic
1055902461 9:81256878-81256900 TCTGTTCTTCATCAGAGTTTTGG - Intergenic
1055972334 9:81924069-81924091 CCTGTTCTGCTTCAGGCTTTTGG + Intergenic
1055974087 9:81939141-81939163 CCTGTTCTGCTTCAGGCTTTTGG + Intergenic
1055979022 9:81983390-81983412 CCTGTTCTGCTTCAGGCTTTTGG + Intergenic
1056291584 9:85148961-85148983 CCTGTTCCATAGCAAGATTTGGG + Intergenic
1056347876 9:85717565-85717587 GCTTTTCAACATAAGGATTTTGG - Intronic
1058624548 9:106921188-106921210 CCTGTTCTACATCAGGATTTAGG - Intronic
1186442025 X:9594773-9594795 CCTCTTCTAAATCAGGATGAGGG - Intronic
1187466020 X:19528452-19528474 CCTGACCCCCATCAGGATTTAGG + Intergenic
1188417206 X:29950454-29950476 TCTGTTCTAGAACAGGATATAGG - Intronic
1188506702 X:30891046-30891068 GCTGCTCTACTTCAGGATGTGGG - Intronic
1188819534 X:34757317-34757339 CTTATTCTCCATCAGGTTTTAGG + Intergenic
1189125173 X:38438078-38438100 CCTGTTCTGCAGCAGGTCTTGGG - Intronic
1192537107 X:71937566-71937588 AATGTTCTAGATCATGATTTGGG - Intergenic
1194933887 X:99923936-99923958 GCTCGTCTACATCAGAATTTAGG - Intergenic
1196624672 X:117864737-117864759 CCTGGTCAACATCTTGATTTCGG - Intergenic
1197056094 X:122121277-122121299 CCTGGTCCACACCATGATTTTGG - Intergenic
1198221061 X:134602854-134602876 ACTGTTCTATATCATGATTGTGG + Intronic
1199220632 X:145311884-145311906 CCTTTTCAATATCAGCATTTTGG + Intergenic
1199267314 X:145843721-145843743 CCTGTTCAACATCTGGATGCAGG - Intergenic
1199860026 X:151792988-151793010 CCTGTTCCAGATGAGGATTTGGG - Intergenic
1202594444 Y:26521713-26521735 GCTGTTCTAGCTCAGGATGTGGG - Intergenic