ID: 1058626603

View in Genome Browser
Species Human (GRCh38)
Location 9:106939852-106939874
Sequence GCTGATTCTGCAATCATTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058626603_1058626606 19 Left 1058626603 9:106939852-106939874 CCTCAAATGATTGCAGAATCAGC 0: 1
1: 0
2: 1
3: 16
4: 145
Right 1058626606 9:106939894-106939916 GGAAGTCTGCAGATTCTTCGAGG No data
1058626603_1058626604 -7 Left 1058626603 9:106939852-106939874 CCTCAAATGATTGCAGAATCAGC 0: 1
1: 0
2: 1
3: 16
4: 145
Right 1058626604 9:106939868-106939890 AATCAGCTGCTTAGAAGAGAAGG No data
1058626603_1058626605 -2 Left 1058626603 9:106939852-106939874 CCTCAAATGATTGCAGAATCAGC 0: 1
1: 0
2: 1
3: 16
4: 145
Right 1058626605 9:106939873-106939895 GCTGCTTAGAAGAGAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058626603 Original CRISPR GCTGATTCTGCAATCATTTG AGG (reversed) Intronic
905963968 1:42073799-42073821 GCTTAATCTGCAATAATTTTGGG + Intergenic
908079793 1:60564160-60564182 CTTGATCCTGAAATCATTTGAGG - Intergenic
908546880 1:65170798-65170820 GCTGATTCTGCAAATTTTTTTGG - Intronic
912151846 1:106869049-106869071 ACTGGGTCTGCAATCATTAGGGG - Intergenic
912276798 1:108266911-108266933 GCTGAATTTACAAACATTTGGGG + Intergenic
912291432 1:108427444-108427466 GCTGAATTTACAAACATTTGGGG - Intronic
916308277 1:163364469-163364491 GCTTATTCTGCAGTCACTTTTGG - Intergenic
916584696 1:166140298-166140320 GCTGATTCCTCATCCATTTGTGG - Intronic
916958133 1:169861513-169861535 GCTGAGTCTTCAGTCATCTGGGG - Intronic
918314892 1:183315212-183315234 GCTGATTCTGAAATCACTCGGGG + Intronic
921300927 1:213750809-213750831 GGTGACACTGCAAACATTTGGGG - Intergenic
921748033 1:218759865-218759887 GTTGATTCTGCGCTCATGTGGGG - Intergenic
924159241 1:241213092-241213114 GCTGATTCAGAACACATTTGGGG + Intronic
1063594669 10:7423404-7423426 TCTAATTCTGCAAACATTCGTGG - Intergenic
1066360264 10:34723383-34723405 GCTGTTTCAGCCATCATTGGTGG - Intronic
1066561976 10:36679503-36679525 GCTGGCTCTGCAGACATTTGGGG + Intergenic
1067203306 10:44193496-44193518 ACTGTTTCTGCAATCTTGTGTGG + Intergenic
1068257587 10:54533401-54533423 GATAATTCTGCAAGAATTTGAGG + Intronic
1070338575 10:75476370-75476392 GCTGAGTCTGCAAACAGTTGGGG - Intronic
1072603908 10:96961238-96961260 GCTAATTCTGCAACCGTTTGGGG + Intronic
1074978972 10:118603905-118603927 GCTGATATTCCAGTCATTTGAGG - Intergenic
1076922636 10:133462772-133462794 GCTGACACTGCTATCATTTTTGG - Intergenic
1077071612 11:676475-676497 GCTGATTCTGCGAACATTTCAGG - Intronic
1078132964 11:8628446-8628468 GCTAATTTTTCTATCATTTGTGG - Intronic
1078819683 11:14865234-14865256 GCTGAATCTGCCATTTTTTGGGG + Intronic
1082187719 11:49204817-49204839 GCGAATCCTGCAATCATTAGAGG + Intronic
1084744911 11:71163731-71163753 GCTCACACTGCAATCTTTTGGGG - Intronic
1088688708 11:112306273-112306295 CCTGACTTTGCAGTCATTTGAGG - Intergenic
1088724497 11:112622150-112622172 GATGTTTCTGCTATAATTTGAGG + Intergenic
1092590634 12:9950828-9950850 GCTGTCTCTGCAATTATCTGTGG - Intergenic
1093038861 12:14356892-14356914 GGTGATTCTGATATCATTAGAGG - Intergenic
1095280774 12:40350150-40350172 GCTGAATATGCAGTCCTTTGGGG + Intronic
1095917218 12:47492036-47492058 GGTGCTTCTCCAGTCATTTGTGG + Intergenic
1096055921 12:48651799-48651821 GCTGAGTCTGCAAGCATGCGTGG + Intergenic
1096445907 12:51691505-51691527 GCTGCTACTACAATCATTTATGG - Intronic
1098035352 12:66295939-66295961 GCTGATACTACAGTCATGTGTGG - Intergenic
1098063996 12:66592746-66592768 GCATATTTTGCAATAATTTGTGG - Intronic
1102802531 12:115749088-115749110 GCTCATTCAGCAATTGTTTGTGG - Intergenic
1108020444 13:46122517-46122539 GTTGATTCAGCAGTCATTTCTGG - Intergenic
1112478079 13:99750207-99750229 GCTGTATCTCCAATCCTTTGAGG - Intronic
1116693433 14:48141096-48141118 TCTGAACCTGCAATCCTTTGGGG - Intergenic
1118276583 14:64390992-64391014 GCGGATTAGGAAATCATTTGAGG + Intronic
1118280301 14:64422225-64422247 AGTGATTCTGCCATCCTTTGGGG - Intronic
1118395468 14:65332450-65332472 GCTGATTCTGCTCTCCTCTGGGG + Intergenic
1120334343 14:83134395-83134417 CCTGAGTCTGCAGTCATTTCAGG - Intergenic
1124183106 15:27496763-27496785 GCTGAGTCTGTAATCAGTAGAGG + Intronic
1125791313 15:42368150-42368172 GGTGTTTTTGCAGTCATTTGTGG + Intronic
1128759988 15:70210023-70210045 ACTGATTCTGCTACCATTTATGG - Intergenic
1129177993 15:73853916-73853938 GCTGATTCTGCTTTCTTATGGGG - Intergenic
1132781344 16:1627853-1627875 GCTGATTCTGAAAACATTCCAGG - Intronic
1133145356 16:3781231-3781253 GCTGATTCTGAAATCAAGTTTGG + Exonic
1138456074 16:57121510-57121532 GCTGATCCTGCTACCATTTTTGG + Intronic
1139416290 16:66813588-66813610 CCTGAATCTGCAATCATATCAGG + Exonic
1141769467 16:86080618-86080640 GGTGATTCTGCAATGATGTCAGG - Intergenic
1145937345 17:28722481-28722503 GATGATTCTTTAATCACTTGAGG + Intronic
1147397226 17:40153540-40153562 GGTAACTCTGTAATCATTTGAGG + Intronic
1147644589 17:42026315-42026337 GCTGGTTCTGAAAGCTTTTGGGG - Intronic
1148708517 17:49658337-49658359 GCTGATTATGAAATAATTTGTGG - Intronic
1155743662 18:29323288-29323310 GCTGAAACTGCAATTATTTCAGG - Intergenic
1156704434 18:39862420-39862442 GCTGCCTCTGCTCTCATTTGAGG - Intergenic
1158784436 18:60692694-60692716 GCTGAATCTGCTGTCATTTGAGG - Intergenic
1167197322 19:48039251-48039273 GCTGTTTCTGCAAGCAATTTGGG + Exonic
925735876 2:6963282-6963304 GGTGAATCTCCAATGATTTGGGG + Intronic
927705124 2:25291920-25291942 GCTCACTCTGAAATCCTTTGAGG - Intronic
928221043 2:29402914-29402936 TCTGGTTCGGTAATCATTTGTGG - Intronic
928940495 2:36722317-36722339 GCTAATGCTGCAGTCGTTTGGGG - Intronic
933940732 2:87242936-87242958 GCTGATTCTCAAAGCATTTGAGG - Intergenic
936352406 2:111723077-111723099 GCTGATTCTCAAAGCATTTGAGG + Intergenic
938409462 2:131051955-131051977 GATGATTCTTCAACCTTTTGGGG - Exonic
938587221 2:132702857-132702879 TCTGAGTCTGTTATCATTTGAGG + Intronic
940497844 2:154456666-154456688 TTTGATTCTGAAATGATTTGAGG + Intergenic
942806548 2:179937691-179937713 GCAGATTATACAATCATTGGGGG - Intergenic
943138918 2:183953151-183953173 GCTGAATATGCAATCATATTTGG + Intergenic
944050575 2:195464034-195464056 GCTGACTATGCAAACATCTGAGG + Intergenic
944050654 2:195465244-195465266 GCTGACTATGCAAACATCTGAGG - Intergenic
949035524 2:241814243-241814265 GCTGATTCCACAGACATTTGGGG + Intronic
1169928406 20:10806903-10806925 GGAAATTCTGCAATCATTGGAGG + Intergenic
1170360335 20:15539352-15539374 GATAATTCTGCGTTCATTTGTGG - Intronic
1173390214 20:42625094-42625116 ACTGATTCTGCAGTTATTTGTGG - Intronic
1177624024 21:23636015-23636037 GATGATTATGAAATCATTTTAGG - Intergenic
1178302314 21:31463371-31463393 GCAGATTCTGGAACCCTTTGAGG - Intronic
1178807368 21:35850908-35850930 GCTGAGTCTGCAAATATTTCTGG - Intronic
1180669112 22:17539416-17539438 GCTGACTCTTCAACCATCTGGGG + Intronic
1182737074 22:32538445-32538467 GGTGATTCTGGAATCTTTTGAGG + Intronic
949314964 3:2742675-2742697 GCTGATTTCTGAATCATTTGAGG - Intronic
949891953 3:8739904-8739926 GCTGAGGCTGCAATCACCTGGGG + Intronic
960445533 3:117744625-117744647 GCTGACTCTGCTATCTTTTAAGG - Intergenic
960877355 3:122310466-122310488 CCTGGTTCTGTAGTCATTTGTGG - Intergenic
963588829 3:147229897-147229919 TCTGATTTTGCAATCAGGTGAGG + Intergenic
964238181 3:154559096-154559118 GCAGATTCTGCCAGCATTTCAGG - Intergenic
965213058 3:165820606-165820628 TCTGATTCTACAATTATTTGTGG - Intronic
965775146 3:172221763-172221785 GATGAATCTGCAATCATTCATGG - Intronic
969147177 4:5134074-5134096 CCTGATTCTGTAAGCATCTGAGG - Intronic
970226889 4:13868188-13868210 GCTGATTTTGCAATCTTTCTAGG - Intergenic
970354170 4:15235936-15235958 GCTGACTCTGCTATCATTTAGGG + Intergenic
971780559 4:31028809-31028831 GCTCATTCTAGAATAATTTGAGG + Intronic
975674352 4:76811714-76811736 AGTCATTCTGCAATCATTTTAGG - Intergenic
978052230 4:104215808-104215830 ACTTATTCTCAAATCATTTGTGG - Intergenic
978141969 4:105328252-105328274 GCTGATTCTGCCATAATATATGG - Intergenic
978708534 4:111747772-111747794 GCTCATATTGGAATCATTTGAGG + Intergenic
982974897 4:162043253-162043275 ACTGATCCTGCAATATTTTGAGG - Intronic
984036521 4:174674895-174674917 TCTGATTCTGCAACTATTTTGGG - Intronic
984832958 4:183992813-183992835 TTTGATTCTACAAGCATTTGAGG + Intronic
985309176 4:188578234-188578256 GTTGATTCTATAATCTTTTGTGG + Intergenic
985810539 5:2080560-2080582 CCTGATTTTGCAAACATTGGTGG - Intergenic
986809729 5:11343690-11343712 TCTGATTCTGCATTTATTTAAGG + Intronic
987588748 5:19894716-19894738 GCTGTTTGTACAAGCATTTGGGG + Intronic
988277018 5:29094030-29094052 GCTTAGTCTCCAATTATTTGTGG + Intergenic
990878077 5:60509397-60509419 GGCGCTTCTGCAGTCATTTGTGG - Intronic
990957175 5:61353680-61353702 GCTGATACTACACTCAGTTGAGG + Intronic
991900506 5:71455600-71455622 GCTGATGGCGCAATCAGTTGCGG + Exonic
992304224 5:75419710-75419732 GCTGATACTGTAATCATCTCGGG - Intronic
992304484 5:75422188-75422210 GCTGATACTGTAATCATCTCGGG - Intronic
993502307 5:88677901-88677923 GGCTATTCTGCAATCAGTTGTGG - Intergenic
994980180 5:106864371-106864393 GCCCATTCAGCAAACATTTGTGG - Intergenic
996415733 5:123208365-123208387 GCTAATCCTGCAATCATTACAGG + Intergenic
998132146 5:139656674-139656696 GCTGCTGCTGTAATCAGTTGCGG + Intronic
998342416 5:141430174-141430196 TCTGATTCAGCTATAATTTGGGG - Intronic
999210521 5:149884653-149884675 GCTGCCTCTGCCATCATCTGGGG - Intronic
1004258117 6:14083761-14083783 GCAGGTTCTGAAATCATTTCAGG - Intergenic
1007113264 6:39325872-39325894 GCTGCTTCTGGAATCCTCTGAGG + Intergenic
1008714570 6:54273403-54273425 GCTGATTAGGCAGTCATTTTAGG + Intergenic
1010520943 6:76836181-76836203 GCAGATTATGGAAACATTTGTGG + Intergenic
1012987015 6:105885849-105885871 GCTGATTCTGCATTGTTCTGTGG - Intergenic
1013251099 6:108334237-108334259 GCTGATGTGGCAATCATTTGAGG - Intronic
1014243244 6:119040957-119040979 GCTGTTTTTGCAAGCATTTGAGG + Intronic
1014253413 6:119138422-119138444 GCTGATTATGCAAGCTCTTGGGG + Intronic
1015125019 6:129744630-129744652 TTTGATACTGGAATCATTTGGGG - Intergenic
1017497872 6:154996961-154996983 GCTGATTCTGAGGTCATTAGGGG - Intronic
1018529330 6:164745816-164745838 GCTGCTTCTGCTATGATTTTAGG - Intergenic
1018700859 6:166424887-166424909 GCTGACTCTGCTACCCTTTGAGG - Intronic
1019878490 7:3837634-3837656 GCTGGCTCTGGAAGCATTTGAGG + Intronic
1021662636 7:22935576-22935598 GCTGATTCTAGAAGCATTTAAGG - Intergenic
1021803788 7:24334912-24334934 GCTGATTCTGCTGTCAACTGAGG - Intergenic
1031037348 7:116802217-116802239 GCTGAGGTGGCAATCATTTGAGG - Intergenic
1032567808 7:132966084-132966106 GATGATTCTGAAATAATTCGAGG - Intronic
1033871556 7:145760816-145760838 TCTGATTCTGCAATGATTTGAGG - Intergenic
1037156253 8:15703098-15703120 TGAGATTCTGTAATCATTTGGGG - Intronic
1037367102 8:18134895-18134917 ACTAACTGTGCAATCATTTGAGG - Intergenic
1037699089 8:21256078-21256100 GCCAATTCTTAAATCATTTGAGG + Intergenic
1038772952 8:30501090-30501112 GTTGATGCTGCTAACATTTGAGG + Intronic
1040545201 8:48393576-48393598 GCTCAATGTGCAATCATTTTAGG - Intergenic
1041545399 8:59036744-59036766 ACTGATTCTTCATACATTTGGGG + Intronic
1041590450 8:59574946-59574968 ACTGATTTTGCAAATATTTGGGG - Intergenic
1046182691 8:110672918-110672940 GCTGATTAGTCACTCATTTGGGG + Intergenic
1047758688 8:127938164-127938186 GCTGTTTCTGGAATGATGTGAGG - Intergenic
1050024420 9:1319383-1319405 GCTGCTTCTGAAATCTTTGGTGG + Intergenic
1052325559 9:27213761-27213783 GCAGATGCTGCAATCATGTTAGG - Intronic
1052390575 9:27874220-27874242 GATAATTCTGCAAGAATTTGTGG + Intergenic
1052400870 9:27998442-27998464 GCTGAGACTGGAATCATCTGAGG - Intronic
1052783606 9:32806833-32806855 GCTTAATCTGCAAGCATTTTGGG - Intergenic
1056513751 9:87330525-87330547 GCTGACTCTGCAGTCTTCTGAGG - Intergenic
1058626603 9:106939852-106939874 GCTGATTCTGCAATCATTTGAGG - Intronic
1058734634 9:107883193-107883215 GCTGTTTCTGTAATCAACTGGGG - Intergenic
1060157525 9:121330061-121330083 GCTCAAGCTGCAATCATTTTTGG - Intronic
1061358780 9:130127037-130127059 GCAGATGCTGCAAGCATTCGAGG - Intronic
1187673074 X:21687832-21687854 GCAAATTCTGAAATCATTTAGGG + Intergenic
1190635535 X:52429738-52429760 GTTAATTCTGCAAACATTTGTGG - Intergenic
1196360311 X:114847041-114847063 GCTGATGCTGTTATCAATTGAGG - Intronic
1196678173 X:118442575-118442597 TCTGATTCTGGAGTCATTTGAGG - Exonic
1197030898 X:121814015-121814037 ACTTATTCTTCAATTATTTGAGG + Intergenic
1197432360 X:126382505-126382527 ACTGTTTCTGCAAACTTTTGTGG - Intergenic
1201905570 Y:19082954-19082976 GCTGATTCTGCATCCCATTGAGG - Intergenic