ID: 1058634573

View in Genome Browser
Species Human (GRCh38)
Location 9:107024023-107024045
Sequence TTGTGTAGACAGATGGTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058634573_1058634580 11 Left 1058634573 9:107024023-107024045 CCATGGACCATCTGTCTACACAA No data
Right 1058634580 9:107024057-107024079 TCCCTGGGTCTCCTGGTCTCAGG No data
1058634573_1058634578 4 Left 1058634573 9:107024023-107024045 CCATGGACCATCTGTCTACACAA No data
Right 1058634578 9:107024050-107024072 TGCTCCTTCCCTGGGTCTCCTGG No data
1058634573_1058634576 -4 Left 1058634573 9:107024023-107024045 CCATGGACCATCTGTCTACACAA No data
Right 1058634576 9:107024042-107024064 ACAAGACCTGCTCCTTCCCTGGG No data
1058634573_1058634582 12 Left 1058634573 9:107024023-107024045 CCATGGACCATCTGTCTACACAA No data
Right 1058634582 9:107024058-107024080 CCCTGGGTCTCCTGGTCTCAGGG No data
1058634573_1058634575 -5 Left 1058634573 9:107024023-107024045 CCATGGACCATCTGTCTACACAA No data
Right 1058634575 9:107024041-107024063 CACAAGACCTGCTCCTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058634573 Original CRISPR TTGTGTAGACAGATGGTCCA TGG (reversed) Intergenic
No off target data available for this crispr