ID: 1058635444

View in Genome Browser
Species Human (GRCh38)
Location 9:107033867-107033889
Sequence ATGAAGAAACAGACTAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058635444_1058635451 14 Left 1058635444 9:107033867-107033889 CCTTCCTTAGTCTGTTTCTTCAT No data
Right 1058635451 9:107033904-107033926 CTCTTCTGGGGCGGTAATGTGGG No data
1058635444_1058635447 1 Left 1058635444 9:107033867-107033889 CCTTCCTTAGTCTGTTTCTTCAT No data
Right 1058635447 9:107033891-107033913 TTGAAAATGACTTCTCTTCTGGG No data
1058635444_1058635450 13 Left 1058635444 9:107033867-107033889 CCTTCCTTAGTCTGTTTCTTCAT No data
Right 1058635450 9:107033903-107033925 TCTCTTCTGGGGCGGTAATGTGG No data
1058635444_1058635448 2 Left 1058635444 9:107033867-107033889 CCTTCCTTAGTCTGTTTCTTCAT No data
Right 1058635448 9:107033892-107033914 TGAAAATGACTTCTCTTCTGGGG No data
1058635444_1058635449 5 Left 1058635444 9:107033867-107033889 CCTTCCTTAGTCTGTTTCTTCAT No data
Right 1058635449 9:107033895-107033917 AAATGACTTCTCTTCTGGGGCGG No data
1058635444_1058635446 0 Left 1058635444 9:107033867-107033889 CCTTCCTTAGTCTGTTTCTTCAT No data
Right 1058635446 9:107033890-107033912 CTTGAAAATGACTTCTCTTCTGG No data
1058635444_1058635452 30 Left 1058635444 9:107033867-107033889 CCTTCCTTAGTCTGTTTCTTCAT No data
Right 1058635452 9:107033920-107033942 ATGTGGGCAGAATGAGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058635444 Original CRISPR ATGAAGAAACAGACTAAGGA AGG (reversed) Intergenic
No off target data available for this crispr