ID: 1058637805

View in Genome Browser
Species Human (GRCh38)
Location 9:107053566-107053588
Sequence ACCAAGAATTTCTCTGTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058637805_1058637807 19 Left 1058637805 9:107053566-107053588 CCAAGAACAGAGAAATTCTTGGT No data
Right 1058637807 9:107053608-107053630 CTCAGCCAGTTCTACATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058637805 Original CRISPR ACCAAGAATTTCTCTGTTCT TGG (reversed) Intergenic
No off target data available for this crispr