ID: 1058637807

View in Genome Browser
Species Human (GRCh38)
Location 9:107053608-107053630
Sequence CTCAGCCAGTTCTACATTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058637805_1058637807 19 Left 1058637805 9:107053566-107053588 CCAAGAACAGAGAAATTCTTGGT No data
Right 1058637807 9:107053608-107053630 CTCAGCCAGTTCTACATTTTAGG No data
1058637802_1058637807 24 Left 1058637802 9:107053561-107053583 CCCAGCCAAGAACAGAGAAATTC No data
Right 1058637807 9:107053608-107053630 CTCAGCCAGTTCTACATTTTAGG No data
1058637803_1058637807 23 Left 1058637803 9:107053562-107053584 CCAGCCAAGAACAGAGAAATTCT No data
Right 1058637807 9:107053608-107053630 CTCAGCCAGTTCTACATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058637807 Original CRISPR CTCAGCCAGTTCTACATTTT AGG Intergenic
No off target data available for this crispr