ID: 1058642714

View in Genome Browser
Species Human (GRCh38)
Location 9:107102875-107102897
Sequence GAACAGGTTGAACATTAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058642714_1058642717 3 Left 1058642714 9:107102875-107102897 CCTTATTAATGTTCAACCTGTTC No data
Right 1058642717 9:107102901-107102923 CCTGAAATCTCCTCTGCCTCAGG No data
1058642714_1058642719 17 Left 1058642714 9:107102875-107102897 CCTTATTAATGTTCAACCTGTTC No data
Right 1058642719 9:107102915-107102937 TGCCTCAGGAGTGCTTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058642714 Original CRISPR GAACAGGTTGAACATTAATA AGG (reversed) Intergenic