ID: 1058646048

View in Genome Browser
Species Human (GRCh38)
Location 9:107132380-107132402
Sequence CCCTAGAATGTCAACCTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058646048_1058646057 27 Left 1058646048 9:107132380-107132402 CCTCAGAGGTTGACATTCTAGGG No data
Right 1058646057 9:107132430-107132452 TCATCAACTGCCTGGATCCCAGG No data
1058646048_1058646051 1 Left 1058646048 9:107132380-107132402 CCTCAGAGGTTGACATTCTAGGG No data
Right 1058646051 9:107132404-107132426 CGCCTTCCTGTGTATTTCAGTGG No data
1058646048_1058646054 19 Left 1058646048 9:107132380-107132402 CCTCAGAGGTTGACATTCTAGGG No data
Right 1058646054 9:107132422-107132444 AGTGGCCCTCATCAACTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058646048 Original CRISPR CCCTAGAATGTCAACCTCTG AGG (reversed) Intergenic
No off target data available for this crispr