ID: 1058646054

View in Genome Browser
Species Human (GRCh38)
Location 9:107132422-107132444
Sequence AGTGGCCCTCATCAACTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058646052_1058646054 -7 Left 1058646052 9:107132406-107132428 CCTTCCTGTGTATTTCAGTGGCC No data
Right 1058646054 9:107132422-107132444 AGTGGCCCTCATCAACTGCCTGG No data
1058646045_1058646054 25 Left 1058646045 9:107132374-107132396 CCCTGTCCTCAGAGGTTGACATT No data
Right 1058646054 9:107132422-107132444 AGTGGCCCTCATCAACTGCCTGG No data
1058646050_1058646054 -4 Left 1058646050 9:107132403-107132425 CCGCCTTCCTGTGTATTTCAGTG No data
Right 1058646054 9:107132422-107132444 AGTGGCCCTCATCAACTGCCTGG No data
1058646046_1058646054 24 Left 1058646046 9:107132375-107132397 CCTGTCCTCAGAGGTTGACATTC No data
Right 1058646054 9:107132422-107132444 AGTGGCCCTCATCAACTGCCTGG No data
1058646048_1058646054 19 Left 1058646048 9:107132380-107132402 CCTCAGAGGTTGACATTCTAGGG No data
Right 1058646054 9:107132422-107132444 AGTGGCCCTCATCAACTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058646054 Original CRISPR AGTGGCCCTCATCAACTGCC TGG Intergenic
No off target data available for this crispr