ID: 1058646057

View in Genome Browser
Species Human (GRCh38)
Location 9:107132430-107132452
Sequence TCATCAACTGCCTGGATCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058646053_1058646057 -3 Left 1058646053 9:107132410-107132432 CCTGTGTATTTCAGTGGCCCTCA No data
Right 1058646057 9:107132430-107132452 TCATCAACTGCCTGGATCCCAGG No data
1058646050_1058646057 4 Left 1058646050 9:107132403-107132425 CCGCCTTCCTGTGTATTTCAGTG No data
Right 1058646057 9:107132430-107132452 TCATCAACTGCCTGGATCCCAGG No data
1058646052_1058646057 1 Left 1058646052 9:107132406-107132428 CCTTCCTGTGTATTTCAGTGGCC No data
Right 1058646057 9:107132430-107132452 TCATCAACTGCCTGGATCCCAGG No data
1058646048_1058646057 27 Left 1058646048 9:107132380-107132402 CCTCAGAGGTTGACATTCTAGGG No data
Right 1058646057 9:107132430-107132452 TCATCAACTGCCTGGATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058646057 Original CRISPR TCATCAACTGCCTGGATCCC AGG Intergenic
No off target data available for this crispr