ID: 1058650347

View in Genome Browser
Species Human (GRCh38)
Location 9:107170090-107170112
Sequence CCTTCCAAGTGTTAGTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058650342_1058650347 11 Left 1058650342 9:107170056-107170078 CCAGCTGTGATGTTTGACATTGT No data
Right 1058650347 9:107170090-107170112 CCTTCCAAGTGTTAGTTTTGGGG 0: 1
1: 0
2: 1
3: 21
4: 163
1058650341_1058650347 19 Left 1058650341 9:107170048-107170070 CCTGACGGCCAGCTGTGATGTTT 0: 1
1: 0
2: 2
3: 8
4: 102
Right 1058650347 9:107170090-107170112 CCTTCCAAGTGTTAGTTTTGGGG 0: 1
1: 0
2: 1
3: 21
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058650347 Original CRISPR CCTTCCAAGTGTTAGTTTTG GGG Intergenic
901780321 1:11589995-11590017 TCTTCCAAGTGTAAGTTTCAAGG - Intergenic
905625786 1:39490224-39490246 ACTTCCAAATGTGATTTTTGGGG + Intergenic
911585098 1:99681372-99681394 CCTTCCCAAAGGTAGTTTTGGGG - Intronic
914948382 1:152087128-152087150 CCTTCCAGGTGTTTGTTCTTAGG + Exonic
917201593 1:172522675-172522697 CCTTCAAAGTGGTAGTATTTGGG + Intergenic
920809499 1:209268763-209268785 CTCTCCATGTGTTTGTTTTGTGG - Intergenic
921766428 1:218977860-218977882 CCTTTCAAGTTTTAGTTTTTTGG + Intergenic
922090271 1:222389252-222389274 TCCTCCAAGTTGTAGTTTTGGGG + Intergenic
923177359 1:231480080-231480102 CAGCCCAAGTGTTAGATTTGAGG - Intergenic
923517598 1:234710395-234710417 CCCTCCAAGAGGCAGTTTTGAGG + Intergenic
924688957 1:246325784-246325806 CATTCCTAGTGTTAAGTTTGTGG - Intronic
1062859553 10:800179-800201 CTTTCCTTCTGTTAGTTTTGGGG - Intergenic
1065365453 10:24931348-24931370 CCTTCCTTCTGTTTGTTTTGGGG - Intronic
1067334750 10:45351490-45351512 CCTTTGAAGTGTTAGATTTAGGG - Intergenic
1067802570 10:49369208-49369230 ACTTCCAAGTTTGGGTTTTGAGG - Intronic
1068312650 10:55297959-55297981 TCTCCCAAATGTTAGTATTGTGG - Intronic
1073189386 10:101640098-101640120 CCTACCAGGTATTAATTTTGTGG - Intronic
1074182162 10:111075238-111075260 CCTTTCCAGTGTTAGTTCTGAGG - Intergenic
1075978598 10:126718287-126718309 CCTTCAAAGTGTTGGTTCTGGGG - Intergenic
1077958170 11:7043967-7043989 CTTACCAAGTGTTAGTTGGGAGG - Exonic
1079558322 11:21789749-21789771 CCTTCCAATTTTTTGTTTTCTGG + Intergenic
1079752011 11:24212136-24212158 TCTTCCACGTATTAATTTTGGGG - Intergenic
1079774596 11:24508559-24508581 TCTTCCAAGTGTTAATTGTGGGG + Intronic
1080225676 11:29957474-29957496 CTTTCCCCGTGTTAGTTTTGAGG + Intergenic
1080982060 11:37419845-37419867 CCTTCCTAGTCTTAATTCTGTGG + Intergenic
1083053298 11:59795918-59795940 CCTTTCAAGTGTGGGTTTTTGGG - Intronic
1084583838 11:70042316-70042338 CCTTCCTAGAGGTAGTTTTCAGG + Intergenic
1093354362 12:18147176-18147198 GCTTTCAAGTGTTAGTGTTTTGG - Intronic
1095344489 12:41133587-41133609 GCTTCCAAGTATGAATTTTGTGG - Intergenic
1096165586 12:49420754-49420776 CCTCCCAAGTGTTAGGATTATGG - Intronic
1096690833 12:53320815-53320837 TCTCACAAGTGTTAGCTTTGTGG - Intronic
1100716549 12:97312305-97312327 CTTTCGAAATGTTAGTTTGGGGG - Intergenic
1101461366 12:104898601-104898623 ACTTCCAAGTGTTAGGTGTATGG + Intronic
1101938907 12:109084276-109084298 CCTTTCAAGTGTCATTTTTGGGG - Intronic
1102968311 12:117146360-117146382 CCTTCCAGGTGGCATTTTTGGGG + Intronic
1105952919 13:25247935-25247957 AATTCCAAGTGATAGTTTTGGGG + Exonic
1106310349 13:28548821-28548843 TCTTGCAACAGTTAGTTTTGAGG + Intergenic
1106797750 13:33224295-33224317 CTTTCCTAGTCTTAGATTTGGGG + Intronic
1106916024 13:34515269-34515291 CCTCCCATGTGTTAGTGGTGTGG + Intergenic
1108725771 13:53179732-53179754 CTTTTGAAGTGTTTGTTTTGTGG + Intergenic
1110135035 13:72056543-72056565 CTTTTCAAGTGTAAGTTTTTAGG - Intergenic
1111904508 13:94239870-94239892 CCTTTCAAGTGTCATTTGTGGGG + Intronic
1112579891 13:100669605-100669627 CTTGCCATGTGTTAGTTGTGCGG + Intronic
1113051748 13:106219695-106219717 CCTTAAAAGTGTTACTTTTGTGG - Intergenic
1114052718 14:18935106-18935128 CCTTCCCAGGGTGACTTTTGTGG + Intergenic
1114109840 14:19466820-19466842 CCTTCCCAGGGTGACTTTTGTGG - Intergenic
1115145652 14:30223113-30223135 CCTTCCAATTCTTATTTTTCAGG + Intergenic
1119220272 14:72900749-72900771 CCTTCCTTGTGTAGGTTTTGAGG - Intergenic
1119446671 14:74670246-74670268 CCATCCAAATGTTAGTTTTTTGG + Intronic
1119968837 14:78946934-78946956 TCTTGCAAGTTTTATTTTTGTGG + Intronic
1120049296 14:79846445-79846467 CATTCTAAGTGTTGGGTTTGAGG - Intronic
1120282188 14:82453859-82453881 CTTTATAAATGTTAGTTTTGGGG + Intergenic
1120882616 14:89426081-89426103 CTTTCCAAGTGTCCTTTTTGTGG - Intronic
1121889313 14:97574229-97574251 ACTTCAAAGTATTAATTTTGGGG + Intergenic
1122164766 14:99814111-99814133 CCTTTCATGTTTTAGTGTTGGGG - Intronic
1124233093 15:27963607-27963629 CCTTCTAAGTATTACTTTAGTGG - Intronic
1127218499 15:56850711-56850733 CCTTCCTATTTTTAGTTTTCTGG - Intronic
1128654084 15:69446538-69446560 CCTTGCAAGTGTTATTCCTGAGG + Intronic
1128873601 15:71183766-71183788 CCTTGAAACTGTTGGTTTTGTGG + Intronic
1130630563 15:85564041-85564063 CCTTCAAAGTGGTAGTATTCCGG - Intronic
1133132278 16:3684531-3684553 CCTCCCAAGTGTTAGATTACAGG - Intronic
1139327340 16:66162727-66162749 CCTTGCAAGTGTTAGCTCTCTGG - Intergenic
1139934886 16:70562741-70562763 CCTTCCCTGATTTAGTTTTGGGG - Intronic
1141268851 16:82521102-82521124 CCTTCAAAGGGCTATTTTTGGGG - Intergenic
1142032697 16:87846451-87846473 GCTTCCACGTCTGAGTTTTGGGG - Intronic
1145827238 17:27886181-27886203 CTTTCCAAATGTTAATTTTGAGG - Intronic
1147345280 17:39788344-39788366 CCCTACAAATGTGAGTTTTGTGG - Exonic
1147349613 17:39830404-39830426 CCTACCATGTGTTAGAGTTGTGG - Intronic
1148982490 17:51590580-51590602 CCTTTCAAGACTGAGTTTTGGGG - Intergenic
1150385293 17:64754525-64754547 CCTTCTGAATGTTAGTTTTGGGG + Intergenic
1150771356 17:68043945-68043967 CCTTCTGAATGTTAGTTTTGGGG - Exonic
1154058569 18:11035735-11035757 TCTTCCCAGAGGTAGTTTTGTGG - Intronic
1156843867 18:41640166-41640188 ACTTTCAAGTCTTATTTTTGAGG + Intergenic
1159830093 18:73266023-73266045 CCTTACAAATGTTAGTTCTTAGG + Intergenic
1160109060 18:76007751-76007773 CCTGCCAAGTGTTGCTTTTAGGG + Intergenic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1162236461 19:9313430-9313452 CTTTCCAAGTTTCAGTGTTGAGG - Intergenic
1162598919 19:11652044-11652066 CCTTATAAATGTAAGTTTTGTGG + Intergenic
1162603122 19:11685251-11685273 CCTTATAAATGTAAGTTTTGTGG + Intergenic
1162616614 19:11806341-11806363 CCTTATAAATGTAAGTTTTGTGG + Exonic
1162619681 19:11831771-11831793 CCTTATAAATGTAAGTTTTGTGG + Exonic
1162623914 19:11867706-11867728 CCTTATAAATGTAAGTTTTGTGG + Exonic
1162637183 19:11978519-11978541 CCTTATAAATGTAAGTTTTGTGG + Exonic
1162641793 19:12016256-12016278 CCTTATAAGTGTAAATTTTGTGG - Exonic
1162656320 19:12133572-12133594 CCTTATAAATGTAAGTTTTGTGG - Exonic
1166760348 19:45220577-45220599 CTTTCGAAGTGTGTGTTTTGGGG + Intronic
925037998 2:706548-706570 CCTTCCCACTCTTGGTTTTGTGG + Intergenic
925069010 2:951315-951337 TCTTCCAAGGTTTGGTTTTGAGG + Intronic
926575449 2:14575629-14575651 CCTTCCAAAAGTCAGTTTTTAGG - Intergenic
929209486 2:39339356-39339378 ACTTCCAAGTGTTATTTTCAGGG - Intronic
931165026 2:59737265-59737287 CCTTCTAAGAGGTAGTTATGAGG + Intergenic
932308100 2:70718134-70718156 CCTACCAACTATTAGGTTTGAGG - Intronic
935106780 2:100052304-100052326 ACTTCCCAATGTAAGTTTTGTGG - Intronic
935678189 2:105614058-105614080 CCTTTCAAAGGATAGTTTTGGGG + Intergenic
935798539 2:106669402-106669424 ACTTCCAGGTTTTCGTTTTGAGG - Intergenic
937009666 2:118551284-118551306 CCTTGAAACTGCTAGTTTTGTGG - Intergenic
942202246 2:173582962-173582984 CCTTCCAGATGTCAGTTTTAGGG + Intergenic
942362089 2:175182773-175182795 TTTTTCAAGTGTTAGTTCTGAGG - Exonic
943508286 2:188790642-188790664 CATGCCAAGTGTTAGCTTTAAGG - Intergenic
1173340440 20:42148348-42148370 CCTTCCAAATCTGACTTTTGAGG - Intronic
1173995608 20:47336463-47336485 CCTGCCATGTGTGCGTTTTGTGG - Intronic
1174135772 20:48378108-48378130 CCTGCCAAGTATTGATTTTGAGG + Intergenic
1177110679 21:17024091-17024113 ACTTTGGAGTGTTAGTTTTGGGG - Intergenic
1177489104 21:21798725-21798747 CTGTCAAAGTCTTAGTTTTGAGG + Intergenic
1177535858 21:22426002-22426024 TGTTCCAAGAGTTATTTTTGAGG - Intergenic
1180471192 22:15657480-15657502 CCTTCCCAGGGTGACTTTTGTGG + Intergenic
1180718880 22:17892026-17892048 TCTTCCCAGTGTTACTTTGGAGG - Intronic
949253740 3:2019971-2019993 CCTCCCAATTGTTAGTTATGTGG + Intergenic
949938274 3:9134383-9134405 CCTTCCCAGTGTAAATTTTTAGG + Intronic
958429542 3:94021716-94021738 GCTTCCTAGTGTTCATTTTGTGG + Intronic
963636613 3:147805715-147805737 ACTTCCATATGTTATTTTTGGGG + Intergenic
965563979 3:170091585-170091607 CCTTCCAAGTGTCATGTTTATGG - Exonic
967977198 3:195042088-195042110 CCGTCTAAGTGTCAGTTTTGAGG + Intergenic
968173560 3:196529284-196529306 CCTTCCCAGTGTGAGAGTTGGGG + Intergenic
969635374 4:8366095-8366117 CCTTCCCAGTGTTAGGTTCCCGG - Intergenic
969886436 4:10219475-10219497 CCTTACAAATGCTAATTTTGAGG + Intergenic
970477856 4:16442052-16442074 CCTTTCAAGTGACAGTTTTGAGG + Intergenic
970809356 4:20073474-20073496 TCTGACAAGTGTTATTTTTGAGG + Intergenic
971730246 4:30370152-30370174 CCTCCCAAATGTTACTTTTTTGG + Intergenic
972441991 4:39103453-39103475 CACTCCAAGTTTTTGTTTTGGGG - Exonic
974132473 4:57773778-57773800 AATTCAAACTGTTAGTTTTGAGG + Intergenic
975104964 4:70557175-70557197 CCTTCCGAGTGTTAGAGTTTGGG - Intergenic
975554395 4:75646382-75646404 GCTTCCAAATTTTGGTTTTGTGG - Exonic
975698590 4:77039602-77039624 CCTTCCTTTTGTTAGTTTTATGG + Intronic
975943464 4:79676162-79676184 CATTCCAACTGGTAATTTTGAGG - Intergenic
979183995 4:117764905-117764927 CCTGCCTAGTTTTACTTTTGAGG - Intergenic
979648241 4:123097690-123097712 CCTTCCAAGTTTTGGCTTTGGGG + Intronic
982648721 4:158058773-158058795 TCTTCCAACTGGTAGTTTTTTGG - Intergenic
982845212 4:160244258-160244280 CATTCCATGTGTATGTTTTGAGG + Intergenic
983263405 4:165481993-165482015 CTTTCAAAGTTTTATTTTTGTGG - Intronic
984388883 4:179101384-179101406 CCTTAAAAGTGTTATTTTGGAGG - Intergenic
984594523 4:181652797-181652819 CATTACATGTGTTTGTTTTGGGG - Intergenic
986269467 5:6218349-6218371 CCTTGCCAGTGTTAGTTGTTTGG - Intergenic
987194414 5:15511111-15511133 CCTTCCAAATGACAGTTTTATGG + Intronic
987887281 5:23829142-23829164 TTTTCCTAGTGTCAGTTTTGTGG - Intergenic
988853368 5:35200976-35200998 CCTTCCAATTTTTAGTTGTATGG + Intronic
991292708 5:65048229-65048251 CCTTGTGAGTGTGAGTTTTGAGG - Intergenic
992419973 5:76593696-76593718 CCTTTCATGTATTAGTTTTTTGG - Intronic
993616619 5:90120174-90120196 TCTTCCAAATGTGAGTTTTTTGG - Intergenic
994783807 5:104129127-104129149 CTTTCCAAGTATTAGATTTTTGG - Intergenic
997730842 5:136173688-136173710 TCTTTCATGGGTTAGTTTTGGGG + Intronic
997903682 5:137792906-137792928 CCTTCCCAATGTTAGTTTTAAGG - Intergenic
999718863 5:154383720-154383742 CTTTCCAAGCGGTAGATTTGTGG + Intronic
1000969626 5:167699211-167699233 CCTTCCAAATTTTAATTTTAAGG - Intronic
1001100862 5:168813244-168813266 CCTTCCACTTGTTAATTTTCTGG - Intronic
1001108995 5:168879913-168879935 CCTTCTAAGTGCTAGTTCTGGGG - Intronic
1009984039 6:70761222-70761244 AGTACCAATTGTTAGTTTTGGGG + Intronic
1010024455 6:71199449-71199471 CCTTCCAAGATTTGGTTTTTGGG + Intergenic
1013257987 6:108408255-108408277 CCTTCTAGGTGTTAGGTTTTAGG + Intronic
1015501880 6:133943110-133943132 CATATCAAGTGTTAATTTTGAGG + Intergenic
1017578832 6:155837652-155837674 CCTTCCCTCTGTGAGTTTTGAGG + Intergenic
1018414747 6:163591229-163591251 CCCTCCAAGAGTATGTTTTGGGG - Intergenic
1018420799 6:163639371-163639393 TCTACAAAGTGTTATTTTTGTGG + Intergenic
1020941573 7:14545623-14545645 GATTCCAAGTGTGAGATTTGTGG - Intronic
1024952017 7:54873172-54873194 AGTTCCATGTGATAGTTTTGTGG - Intergenic
1028696443 7:93718516-93718538 GCTTCTAAGTGTTATTTTTAGGG + Intronic
1029178034 7:98678915-98678937 CATTCCCAGTCTAAGTTTTGAGG - Intergenic
1030683884 7:112463087-112463109 CCTTCCAATGGTAAGATTTGAGG - Intronic
1031289890 7:119920826-119920848 CCTTACAAGTATTAATTTAGAGG + Intergenic
1032489378 7:132312584-132312606 CTGTCAAAGTGTTAGTTTTTAGG + Intronic
1032833193 7:135650091-135650113 GCTTCCAAGCGTTGGTTTTTGGG + Intergenic
1035825505 8:2640350-2640372 GCTTCCATGTGTTATATTTGTGG - Intergenic
1035939561 8:3882404-3882426 CCTGCCAAATGTTGGTTATGTGG + Intronic
1038125363 8:24667337-24667359 CCTTGCCAATGTTAGTTTTCAGG + Intergenic
1041175423 8:55192006-55192028 CCTTAAAAGTGTTACTTTTGTGG + Intronic
1043534296 8:81184753-81184775 CTTTTCTAATGTTAGTTTTGAGG - Intergenic
1044261906 8:90134780-90134802 GCTTTGAAGTGTTAGTTTTATGG - Intergenic
1045291585 8:100837593-100837615 CCTTCAACGTGTGAATTTTGTGG - Intergenic
1047117457 8:121860300-121860322 CCTCCCGAGGCTTAGTTTTGAGG - Intergenic
1047292956 8:123545758-123545780 CCATCAAACTGTAAGTTTTGAGG + Intergenic
1049028813 8:140017240-140017262 CCTATCAAGTCTTAGTTTTATGG + Intronic
1051317024 9:15849802-15849824 CCTTCAAAAGGTTAGTTTTAGGG - Intronic
1052772499 9:32702747-32702769 CTTTCCAAATCTGAGTTTTGAGG - Intergenic
1055768613 9:79692077-79692099 CCTCCCCCATGTTAGTTTTGAGG + Intronic
1058620780 9:106880583-106880605 CCTTTCTGGTGTCAGTTTTGTGG + Intronic
1058650347 9:107170090-107170112 CCTTCCAAGTGTTAGTTTTGGGG + Intergenic
1059853581 9:118370173-118370195 CCTTACTAGTGTAAGTGTTGTGG + Intergenic
1060279438 9:122206108-122206130 CTTTCCAAGTGTTGGATTTGTGG + Intronic
1061443043 9:130619714-130619736 CTTGCCAAGTGTGTGTTTTGGGG + Intronic
1189151341 X:38710576-38710598 CCTCCTAAGTGTTGCTTTTGTGG - Intergenic
1191912236 X:66163395-66163417 TCTTCCATGTCTTAGTTTTTAGG + Intronic
1194374746 X:93118260-93118282 CCTTCCAACTTTTAGGTTTAGGG - Intergenic
1194378290 X:93163222-93163244 CCTTGCAATTCTGAGTTTTGGGG - Intergenic
1194980456 X:100434858-100434880 ACTCCCAAGTGTTAGCTTTTGGG - Intergenic
1198043405 X:132876495-132876517 CCTTGCAAGTTTTAGTTTTGAGG + Intronic
1198144951 X:133845872-133845894 CCATCCAGGTGTTAGATTTGGGG + Intronic