ID: 1058655676

View in Genome Browser
Species Human (GRCh38)
Location 9:107218438-107218460
Sequence CCTGTTCACCAGAGAGCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058655671_1058655676 18 Left 1058655671 9:107218397-107218419 CCTGCACTGCTCAGCTCCACTCA No data
Right 1058655676 9:107218438-107218460 CCTGTTCACCAGAGAGCTCAAGG No data
1058655674_1058655676 -8 Left 1058655674 9:107218423-107218445 CCTACATTATTAAATCCTGTTCA No data
Right 1058655676 9:107218438-107218460 CCTGTTCACCAGAGAGCTCAAGG No data
1058655673_1058655676 -7 Left 1058655673 9:107218422-107218444 CCCTACATTATTAAATCCTGTTC No data
Right 1058655676 9:107218438-107218460 CCTGTTCACCAGAGAGCTCAAGG No data
1058655672_1058655676 2 Left 1058655672 9:107218413-107218435 CCACTCATGCCCTACATTATTAA No data
Right 1058655676 9:107218438-107218460 CCTGTTCACCAGAGAGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058655676 Original CRISPR CCTGTTCACCAGAGAGCTCA AGG Intergenic
No off target data available for this crispr