ID: 1058656525

View in Genome Browser
Species Human (GRCh38)
Location 9:107226951-107226973
Sequence ATATTAATAGCCTCAGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058656525_1058656527 2 Left 1058656525 9:107226951-107226973 CCTTCTTCTGAGGCTATTAATAT No data
Right 1058656527 9:107226976-107226998 GAGAACTTATGTGCAGAAGGAGG No data
1058656525_1058656528 6 Left 1058656525 9:107226951-107226973 CCTTCTTCTGAGGCTATTAATAT No data
Right 1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG No data
1058656525_1058656526 -1 Left 1058656525 9:107226951-107226973 CCTTCTTCTGAGGCTATTAATAT No data
Right 1058656526 9:107226973-107226995 TGAGAGAACTTATGTGCAGAAGG No data
1058656525_1058656530 30 Left 1058656525 9:107226951-107226973 CCTTCTTCTGAGGCTATTAATAT No data
Right 1058656530 9:107227004-107227026 CAAATGACACCTCTAGAGGTTGG No data
1058656525_1058656529 26 Left 1058656525 9:107226951-107226973 CCTTCTTCTGAGGCTATTAATAT No data
Right 1058656529 9:107227000-107227022 TGGTCAAATGACACCTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058656525 Original CRISPR ATATTAATAGCCTCAGAAGA AGG (reversed) Intergenic
No off target data available for this crispr