ID: 1058656528

View in Genome Browser
Species Human (GRCh38)
Location 9:107226980-107227002
Sequence ACTTATGTGCAGAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058656525_1058656528 6 Left 1058656525 9:107226951-107226973 CCTTCTTCTGAGGCTATTAATAT No data
Right 1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058656528 Original CRISPR ACTTATGTGCAGAAGGAGGA TGG Intergenic
No off target data available for this crispr