ID: 1058656708

View in Genome Browser
Species Human (GRCh38)
Location 9:107228917-107228939
Sequence TGTTGACTCCTCGGGGGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058656699_1058656708 22 Left 1058656699 9:107228872-107228894 CCTTCTGAGGGAAAATCAATTCT No data
Right 1058656708 9:107228917-107228939 TGTTGACTCCTCGGGGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058656708 Original CRISPR TGTTGACTCCTCGGGGGATG GGG Intergenic
No off target data available for this crispr