ID: 1058656743

View in Genome Browser
Species Human (GRCh38)
Location 9:107229218-107229240
Sequence AAGGGGATACGGAGGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058656729_1058656743 13 Left 1058656729 9:107229182-107229204 CCAAACAACAGTGCAAATGGATT No data
Right 1058656743 9:107229218-107229240 AAGGGGATACGGAGGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058656743 Original CRISPR AAGGGGATACGGAGGGGGCA GGG Intergenic
No off target data available for this crispr