ID: 1058657745 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:107239646-107239668 |
Sequence | CCTCATAAGCAGTGATTCTC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1058657743_1058657745 | -8 | Left | 1058657743 | 9:107239631-107239653 | CCTGTCTTCAAAATTCCTCATAA | No data | ||
Right | 1058657745 | 9:107239646-107239668 | CCTCATAAGCAGTGATTCTCTGG | No data | ||||
1058657742_1058657745 | 16 | Left | 1058657742 | 9:107239607-107239629 | CCAGTTGCTCATCACAAAGAGCA | No data | ||
Right | 1058657745 | 9:107239646-107239668 | CCTCATAAGCAGTGATTCTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1058657745 | Original CRISPR | CCTCATAAGCAGTGATTCTC TGG | Intergenic | ||
No off target data available for this crispr |