ID: 1058657745

View in Genome Browser
Species Human (GRCh38)
Location 9:107239646-107239668
Sequence CCTCATAAGCAGTGATTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058657743_1058657745 -8 Left 1058657743 9:107239631-107239653 CCTGTCTTCAAAATTCCTCATAA No data
Right 1058657745 9:107239646-107239668 CCTCATAAGCAGTGATTCTCTGG No data
1058657742_1058657745 16 Left 1058657742 9:107239607-107239629 CCAGTTGCTCATCACAAAGAGCA No data
Right 1058657745 9:107239646-107239668 CCTCATAAGCAGTGATTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058657745 Original CRISPR CCTCATAAGCAGTGATTCTC TGG Intergenic
No off target data available for this crispr