ID: 1058657838

View in Genome Browser
Species Human (GRCh38)
Location 9:107240570-107240592
Sequence CTTTGTGAGGGGGAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058657826_1058657838 17 Left 1058657826 9:107240530-107240552 CCCTGGCTGGGCACGGTGGCTCA 0: 117
1: 1028
2: 3136
3: 5999
4: 7440
Right 1058657838 9:107240570-107240592 CTTTGTGAGGGGGAGGTGGGTGG No data
1058657827_1058657838 16 Left 1058657827 9:107240531-107240553 CCTGGCTGGGCACGGTGGCTCAT 0: 198
1: 1350
2: 4594
3: 8838
4: 11080
Right 1058657838 9:107240570-107240592 CTTTGTGAGGGGGAGGTGGGTGG No data
1058657825_1058657838 18 Left 1058657825 9:107240529-107240551 CCCCTGGCTGGGCACGGTGGCTC 0: 33
1: 210
2: 990
3: 2475
4: 4411
Right 1058657838 9:107240570-107240592 CTTTGTGAGGGGGAGGTGGGTGG No data
1058657828_1058657838 -8 Left 1058657828 9:107240555-107240577 CCTGTAATCCCAGCACTTTGTGA 0: 1786
1: 298626
2: 265319
3: 148850
4: 129231
Right 1058657838 9:107240570-107240592 CTTTGTGAGGGGGAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058657838 Original CRISPR CTTTGTGAGGGGGAGGTGGG TGG Intergenic
No off target data available for this crispr