ID: 1058659264

View in Genome Browser
Species Human (GRCh38)
Location 9:107254519-107254541
Sequence TTTATTATCAGAAGGTTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058659264_1058659266 -9 Left 1058659264 9:107254519-107254541 CCAGACAACCTTCTGATAATAAA No data
Right 1058659266 9:107254533-107254555 GATAATAAAGCCTTTTTCCATGG No data
1058659264_1058659267 -1 Left 1058659264 9:107254519-107254541 CCAGACAACCTTCTGATAATAAA No data
Right 1058659267 9:107254541-107254563 AGCCTTTTTCCATGGCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058659264 Original CRISPR TTTATTATCAGAAGGTTGTC TGG (reversed) Intergenic
No off target data available for this crispr