ID: 1058661206

View in Genome Browser
Species Human (GRCh38)
Location 9:107271024-107271046
Sequence CTGTGTAAGTTCAGGTACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058661206_1058661209 8 Left 1058661206 9:107271024-107271046 CCCAGGTACCTGAACTTACACAG No data
Right 1058661209 9:107271055-107271077 CAACAAATAAGAGATTTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058661206 Original CRISPR CTGTGTAAGTTCAGGTACCT GGG (reversed) Intergenic
No off target data available for this crispr