ID: 1058663266

View in Genome Browser
Species Human (GRCh38)
Location 9:107284459-107284481
Sequence CCCCTTGAACTGCTACTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058663266 Original CRISPR CCCCTTGAACTGCTACTGTT TGG (reversed) Intronic
901081814 1:6587989-6588011 CCCCTTGCTCTGCTACAGCTAGG - Intronic
909186106 1:72488241-72488263 CCCCTTGAACTATTAGTGTATGG + Intergenic
909934377 1:81533801-81533823 CCCCTTGGACTCCTAGTGTGAGG - Intronic
911836814 1:102630198-102630220 CACCTTGAACTGCTGCTGGCTGG - Intergenic
919519517 1:198570464-198570486 CTCCTTCAAATTCTACTGTTTGG + Intergenic
919594683 1:199547170-199547192 CCACTTGAGCTTCTACTCTTTGG - Intergenic
1074505473 10:114066602-114066624 CCCCGTGAAATGCATCTGTTCGG + Intergenic
1075861934 10:125684428-125684450 TCCCTTGCACTGCTGCTGCTGGG - Intergenic
1076483092 10:130797564-130797586 TCCCTTGCCCTGCAACTGTTTGG + Intergenic
1089300050 11:117493068-117493090 CCCCTTGCACACATACTGTTCGG - Intronic
1089457602 11:118634546-118634568 TCCCTTGAACTGAAATTGTTGGG - Intronic
1090654465 11:128832448-128832470 ACCCTTGCACTGCTTCTTTTGGG - Intergenic
1092202423 12:6594191-6594213 CCCCTAGAACTGATACTCTATGG + Intronic
1115601956 14:34963569-34963591 CCCCATGAACTGCTATTCTGTGG + Intergenic
1127618362 15:60709458-60709480 CCCCTGGTACTGGTCCTGTTAGG + Intronic
1128303949 15:66585944-66585966 CCCCTTGAGCTGCTACAGGTGGG - Intronic
1128515704 15:68340619-68340641 CCCCTTGTCCTGCAACTGGTGGG - Intronic
1130959388 15:88649663-88649685 TCCCTTGAGCTGCTACTCTGAGG + Intronic
1135348725 16:21711112-21711134 CCCCTTGAGCTCCTACTCTGTGG - Intronic
1138213173 16:55180203-55180225 CCCCTGGAACTGCCCCTGCTTGG - Intergenic
1141692943 16:85606787-85606809 CCCCTTGCCCTGTTACTGTCTGG - Intergenic
1143956071 17:10670227-10670249 TCCCTTGACCTACTACTCTTTGG - Intergenic
1156460247 18:37317716-37317738 CTCCCTGAACTGCTCCTGATAGG + Intronic
1157777596 18:50407990-50408012 CCCCTTCTCCTCCTACTGTTAGG + Intergenic
1158172378 18:54614254-54614276 CCACTTGCACTGCTATAGTTGGG - Intergenic
1158468417 18:57712577-57712599 CCCCATGAACTACAACTCTTAGG + Intronic
1163678757 19:18668851-18668873 CGCCTTGAACTCCCACTGGTCGG - Exonic
927396578 2:22658032-22658054 CCTCTCAAACTGCTGCTGTTTGG - Intergenic
930105243 2:47634095-47634117 CCCACTGAACAGCTACTGTTAGG - Intergenic
936050028 2:109215714-109215736 CCCTGTGAACTGCCACTGCTAGG + Intronic
937947048 2:127349485-127349507 GCCCTTGAAATGGTACTGATAGG - Intronic
937987367 2:127644060-127644082 CCCCAGGACCTGCTACTGCTGGG + Intronic
942015946 2:171815485-171815507 CTCATTTATCTGCTACTGTTGGG + Intronic
943530877 2:189078673-189078695 CCCCTGGAAATACTACTGCTTGG - Intronic
944544737 2:200788029-200788051 CATCTTGAACGGCTAGTGTTTGG - Intergenic
946506347 2:220304849-220304871 CCCCTTATACTACTTCTGTTGGG - Intergenic
947990133 2:234480504-234480526 CCACTTTAACTGCTACAGTTGGG - Intergenic
1173476067 20:43360596-43360618 CCACTTCAACTGCTGCTGCTTGG + Intergenic
1177185758 21:17794207-17794229 ATCCTTGATCTGCTACTGATTGG + Intronic
1183394854 22:37565988-37566010 CCTCTTCAGCTGCTAATGTTTGG + Intronic
1184843327 22:47065490-47065512 CTCCTGGACCTGCTTCTGTTGGG + Intronic
950999997 3:17547034-17547056 CACCTAGATCTGCTACTGATTGG - Intronic
957373258 3:79323815-79323837 CAACTTGAACTGCCACTGCTGGG - Intronic
959406406 3:105966556-105966578 CTCCTAGTACTGCTACTGGTCGG - Intergenic
963382210 3:144545167-144545189 CCCCTTGAATGGCTATTGATTGG + Intergenic
967218599 3:187230480-187230502 CCCCTTAAGCTGCTTATGTTTGG + Intronic
969317696 4:6391813-6391835 CCCCCAGAACTGCCACTGTGTGG + Intronic
969995637 4:11309699-11309721 GCCCTCTAATTGCTACTGTTGGG - Intergenic
974317297 4:60298706-60298728 CCCCTTGAACTCCTGCAGCTAGG - Intergenic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
978254488 4:106677837-106677859 CCCACTGATCTACTACTGTTGGG + Intergenic
980310226 4:131118674-131118696 CCCCTTGAACAGCTGCTGTCTGG + Intergenic
981538456 4:145824440-145824462 CCCCTGGAACTTCCACTGTCTGG - Intronic
984938055 4:184907019-184907041 CCCCTTGAAGTGGCCCTGTTGGG + Intergenic
995322578 5:110853539-110853561 ACCCTAGTACTCCTACTGTTTGG + Intergenic
995948302 5:117678496-117678518 CACCTAGAACTGCTATTGTTAGG + Intergenic
998449909 5:142226181-142226203 GCCCTTGGTCTGCTACTGTTTGG + Intergenic
1000257903 5:159558431-159558453 TCCCTTAAACTGCAGCTGTTTGG + Intergenic
1004064839 6:12233843-12233865 CTCCTTGAACTGCTGCTCATGGG + Intergenic
1004202976 6:13566717-13566739 CCTCTTGAACTTCCACTGGTAGG + Intergenic
1004979938 6:21012094-21012116 CCCCTTGCCTTCCTACTGTTTGG - Intronic
1005235203 6:23753612-23753634 CCTCTTTATCTCCTACTGTTTGG - Intergenic
1008393157 6:50976429-50976451 CCACTTGAATTTCTATTGTTAGG + Intergenic
1013277202 6:108596858-108596880 CCCTTTGAGCTGCAACTGTTTGG - Intronic
1013970440 6:116011774-116011796 CCCCTTGAACTATTATGGTTCGG + Intronic
1014229959 6:118892609-118892631 CCACTTTATCTGCTAGTGTTAGG + Intronic
1016253576 6:142076749-142076771 CCCCTTGAACTACTGATGTTAGG - Intronic
1024581100 7:50801855-50801877 CTCCTTGCCCTCCTACTGTTAGG + Intergenic
1032965108 7:137087514-137087536 TCCCTTGAAGTTCTATTGTTTGG + Intergenic
1035740585 8:1925385-1925407 CACCTTGAACTCCTGCTGCTTGG - Exonic
1039452078 8:37683213-37683235 GCCCTTGAACTGCTTCTTATGGG - Intergenic
1045788550 8:105955079-105955101 CCCCTTGCACTTCTACGGTGAGG - Intergenic
1050155315 9:2661083-2661105 CCCCTTGAAATGCTAGCATTTGG + Intergenic
1051003817 9:12317633-12317655 CCACTGGAACTAATACTGTTAGG - Intergenic
1056464810 9:86843172-86843194 CACCATCAACTGCTCCTGTTAGG + Intergenic
1057167534 9:92940673-92940695 CCCCTCGAAGAGCTACTGTAGGG + Intergenic
1058576887 9:106413287-106413309 CCCATTGAAAGGCGACTGTTAGG - Intergenic
1058663266 9:107284459-107284481 CCCCTTGAACTGCTACTGTTTGG - Intronic
1058760132 9:108122540-108122562 GCCCTTGAGCTGCTGCTGCTTGG + Intergenic
1186783040 X:12932377-12932399 CTCCTTGAACTGGTCCTATTAGG + Intergenic
1187179708 X:16932411-16932433 CACCTTGAACTCATACTGCTTGG + Intergenic
1188033401 X:25289619-25289641 CCGTTTGACCTGCTCCTGTTTGG + Intergenic
1189346184 X:40243153-40243175 ACCCTTGGAGTGGTACTGTTAGG - Intergenic
1189704839 X:43749615-43749637 CCCATTGAGGTGTTACTGTTTGG - Intergenic
1191234273 X:58121536-58121558 CCCATTAAAATGCTAGTGTTGGG - Intergenic
1193912822 X:87327100-87327122 TCCCTTGACCTGCTACTCATGGG + Intergenic