ID: 1058670899

View in Genome Browser
Species Human (GRCh38)
Location 9:107359683-107359705
Sequence GAACTCAAGGTTCCAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058670888_1058670899 14 Left 1058670888 9:107359646-107359668 CCTAAAACCCCCTGCAGTGATCG No data
Right 1058670899 9:107359683-107359705 GAACTCAAGGTTCCAGAAGCAGG No data
1058670891_1058670899 7 Left 1058670891 9:107359653-107359675 CCCCCTGCAGTGATCGGGTCTAC No data
Right 1058670899 9:107359683-107359705 GAACTCAAGGTTCCAGAAGCAGG No data
1058670894_1058670899 4 Left 1058670894 9:107359656-107359678 CCTGCAGTGATCGGGTCTACTTC No data
Right 1058670899 9:107359683-107359705 GAACTCAAGGTTCCAGAAGCAGG No data
1058670893_1058670899 5 Left 1058670893 9:107359655-107359677 CCCTGCAGTGATCGGGTCTACTT No data
Right 1058670899 9:107359683-107359705 GAACTCAAGGTTCCAGAAGCAGG No data
1058670887_1058670899 15 Left 1058670887 9:107359645-107359667 CCCTAAAACCCCCTGCAGTGATC No data
Right 1058670899 9:107359683-107359705 GAACTCAAGGTTCCAGAAGCAGG No data
1058670892_1058670899 6 Left 1058670892 9:107359654-107359676 CCCCTGCAGTGATCGGGTCTACT No data
Right 1058670899 9:107359683-107359705 GAACTCAAGGTTCCAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058670899 Original CRISPR GAACTCAAGGTTCCAGAAGC AGG Intergenic
No off target data available for this crispr