ID: 1058675328

View in Genome Browser
Species Human (GRCh38)
Location 9:107395321-107395343
Sequence GTTTTACAGGGGTTTTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058675328_1058675333 -10 Left 1058675328 9:107395321-107395343 CCATCCAAAAACCCCTGTAAAAC No data
Right 1058675333 9:107395334-107395356 CCTGTAAAACAATACTGTGCAGG No data
1058675328_1058675334 21 Left 1058675328 9:107395321-107395343 CCATCCAAAAACCCCTGTAAAAC No data
Right 1058675334 9:107395365-107395387 TTCACTAGACTAAGATGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058675328 Original CRISPR GTTTTACAGGGGTTTTTGGA TGG (reversed) Intergenic
No off target data available for this crispr