ID: 1058681860

View in Genome Browser
Species Human (GRCh38)
Location 9:107447058-107447080
Sequence GTGGAGAGACAGCCACTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058681855_1058681860 29 Left 1058681855 9:107447006-107447028 CCGAACTTGGAAGGGTTTGCATG No data
Right 1058681860 9:107447058-107447080 GTGGAGAGACAGCCACTGAAAGG No data
1058681854_1058681860 30 Left 1058681854 9:107447005-107447027 CCCGAACTTGGAAGGGTTTGCAT No data
Right 1058681860 9:107447058-107447080 GTGGAGAGACAGCCACTGAAAGG No data
1058681858_1058681860 6 Left 1058681858 9:107447029-107447051 CCTGACTCAGGCTGGATCATCTC No data
Right 1058681860 9:107447058-107447080 GTGGAGAGACAGCCACTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058681860 Original CRISPR GTGGAGAGACAGCCACTGAA AGG Intergenic
No off target data available for this crispr