ID: 1058681934

View in Genome Browser
Species Human (GRCh38)
Location 9:107447591-107447613
Sequence TAGAGAAGTAGAGTGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058681930_1058681934 15 Left 1058681930 9:107447553-107447575 CCCTGGAGGAGGAGGAGGATGAC No data
Right 1058681934 9:107447591-107447613 TAGAGAAGTAGAGTGAGTGCTGG No data
1058681929_1058681934 16 Left 1058681929 9:107447552-107447574 CCCCTGGAGGAGGAGGAGGATGA No data
Right 1058681934 9:107447591-107447613 TAGAGAAGTAGAGTGAGTGCTGG No data
1058681931_1058681934 14 Left 1058681931 9:107447554-107447576 CCTGGAGGAGGAGGAGGATGACA No data
Right 1058681934 9:107447591-107447613 TAGAGAAGTAGAGTGAGTGCTGG No data
1058681932_1058681934 -9 Left 1058681932 9:107447577-107447599 CCCAGACTTGTCTTTAGAGAAGT No data
Right 1058681934 9:107447591-107447613 TAGAGAAGTAGAGTGAGTGCTGG No data
1058681933_1058681934 -10 Left 1058681933 9:107447578-107447600 CCAGACTTGTCTTTAGAGAAGTA No data
Right 1058681934 9:107447591-107447613 TAGAGAAGTAGAGTGAGTGCTGG No data
1058681926_1058681934 23 Left 1058681926 9:107447545-107447567 CCAAATGCCCCTGGAGGAGGAGG No data
Right 1058681934 9:107447591-107447613 TAGAGAAGTAGAGTGAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058681934 Original CRISPR TAGAGAAGTAGAGTGAGTGC TGG Intergenic
No off target data available for this crispr