ID: 1058682548

View in Genome Browser
Species Human (GRCh38)
Location 9:107452728-107452750
Sequence GGATCTATGGATCTGAGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058682548_1058682557 22 Left 1058682548 9:107452728-107452750 CCCAGTCTCAGATCCATAGATCC No data
Right 1058682557 9:107452773-107452795 CTTTTTACCTCTCACCTCACTGG No data
1058682548_1058682558 23 Left 1058682548 9:107452728-107452750 CCCAGTCTCAGATCCATAGATCC No data
Right 1058682558 9:107452774-107452796 TTTTTACCTCTCACCTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058682548 Original CRISPR GGATCTATGGATCTGAGACT GGG (reversed) Intergenic
No off target data available for this crispr