ID: 1058696045 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:107559778-107559800 |
Sequence | TGCCTAAGTGACCCTGTATC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1058696045_1058696047 | -7 | Left | 1058696045 | 9:107559778-107559800 | CCTGATACAGGGTCACTTAGGCA | No data | ||
Right | 1058696047 | 9:107559794-107559816 | TTAGGCAACTCTGATAGTTTGGG | No data | ||||
1058696045_1058696046 | -8 | Left | 1058696045 | 9:107559778-107559800 | CCTGATACAGGGTCACTTAGGCA | No data | ||
Right | 1058696046 | 9:107559793-107559815 | CTTAGGCAACTCTGATAGTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1058696045 | Original CRISPR | TGCCTAAGTGACCCTGTATC AGG (reversed) | Intergenic | ||