ID: 1058696045

View in Genome Browser
Species Human (GRCh38)
Location 9:107559778-107559800
Sequence TGCCTAAGTGACCCTGTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1058696045_1058696046 -8 Left 1058696045 9:107559778-107559800 CCTGATACAGGGTCACTTAGGCA No data
Right 1058696046 9:107559793-107559815 CTTAGGCAACTCTGATAGTTTGG No data
1058696045_1058696047 -7 Left 1058696045 9:107559778-107559800 CCTGATACAGGGTCACTTAGGCA No data
Right 1058696047 9:107559794-107559816 TTAGGCAACTCTGATAGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1058696045 Original CRISPR TGCCTAAGTGACCCTGTATC AGG (reversed) Intergenic
No off target data available for this crispr